Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23783  (registered. 2003)
Contig Information
Length 1617 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_OKCS Seed DPA5 6
Wh_RDr Root of dessiccated seed 6
Wh_SHDr Shoot grown with dessication 1
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit mitochondrial uncoupling protein 2 [Saccharum officinarum]
Score 1346
Evalue 2.39032e-146
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23783
ACGCATTTCACAGGGAACTGCGAGCAGTTTATTATGCCCAGCTGTTTAAGAAGAGTCGAGATGATCACAACTCCACAACTAATAATACACGAGCACTGGC
AAACAAAGCCATTCTGATGCAACATGGGAGAAACGAAAATTGATCACTGTAGGGTTTACATACATCCAGACACCAGCCAGTTCCTCCTTTGGGGAATAAT
AATAATGTCGACACATCCATGGCCGCTCTTATTGCCTCGTGCCGAATTCGGCACGAGGCTTCCCTCTTCCTCTTTATTTCCCCCCTTTCCTTCCTTCCTT
CGTTCCTCTGTGTGTGTGTGACAGCACTTGTGACAGAAGGGGTCCGTCGTCTCGCTCGGTGGTGCCGGTGGTGGGCGGTTGCATCCACCCGTCAGCCAAG
CCAAGCCAAGCATGGCGCCGGACCACGGCTCCAAGGTCGACATCTCCTTCGCCGGCCGCTTCACCGCCAGCGCCATCGCCGCCTGCTTCGCCGAGATCAC
CACGATCCCCCTCGACACGGCCAAGGTCAGGCTGCAGCTGCAGAAGAAGGCCGTCGCCGGGGATCTCGCTGGGCCCAAGTACCGTGGCCTGCTCGGCACC
GCCGCCACCATCGCCAAGGAGGAAGGCGCCGCCGCGCTCTGGAAGGGCATCGTCCCTGGCCTCCACCGCCAGTGCATCTACGGCGGTCTCCGCATTGGTC
TCTATGAGCCAGTCAAATCCTTCTATGTTGGTGAGAACCATGTTGGGGATGTACCTTTGTCCAAGAAGATAGCCGCTGGCTTCACCACTGGTGCCCTTGC
AATCGCTGTGGCCAACCCCACTGACCTTGTCAAAGTCAGGCTTCAGTCTGAGGGGAAGCTGGCACCTGGTGTGCCGCGCCGTTATACTGGGGCAATGGAT
GCTTATGCCAAGATTGTTAGGCAGGAAGGGGTTGCTGCTCTGTGGACTGGCATTGGTCCGAATGTTGCACGTAACGCCATCATAAACGCTGCTGAGTTGG
CCAGTTATGATCAAGTGAAGCAGTCCATTTTGAAACTTCCTGGGTTCAAAGATGACGTGGTCACTCATATCTTGTCTGGTTTGGGCGCTGGCTTCTTTGC
TGTCTGTGTGGGTTCTCCGGTTGATGTGGTTAAGTCAAGAATGATGGGTGACTCTGCCTACAAGAACACTATTGATTGTTTTGTGAAGACCCTAAAGAAT
GATGGACCTCTGGCGTTTTACAAAGGCTTCCTTCCAAACTTTGCTAGACTGGGATCATGGAATGTGATCATGTTCTTGACACTGGAGCAGGTTCAGAAGG
CCTTTGTGAGAAAGCCTGCAAATTAAAGATGAGATGATATGGGTTTTGTAGAGGGTGGTATACAACAAGAATGTGCGCATTTGTTTTCTCCTACATAAGA
CGTTAACCCTTGGGAGTTTGAGGTACAAAGGACAAATTTGAGACCCCAACTGTGAGAAACTATAATAAATTTTTGTCGGTCTTGACAGGACCTTAAACAA
ATGCTGAGGTAGTTCGGATATGTCAAAGTGTTGTTAAATTTGTGTTGGATGGATGAACATTAGCTGCAGTACATCTTATCTGTGATGATGAGCCAGGAAG
GCGCACTGCCTTTGCTT
page-top