Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23776  (registered. 2003)
Contig Information
Length 820 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 4
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 4
Homology (BLAST) Top Hit hypothetical protein OsJ_018551 [Oryza sativa (japonica cultivar-group)]
Score 218
Evalue 5.46162e-16
Total Hit Count 249
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23776
TTGCTTCCTATAGTAAGCCTTGCTTCCTCTCGACCAAGGCTAGCTTTCGCAATGGCGCCATCGACCAAGCTCTTCCTCGTGCTCCTCGGCCTAAACTTGA
TGGTCACCGCTGTGCACGGTGGTTGCGGACCCCACTGCCCTACCCCGACCCCACCGCCGCCTCCATCGACCAACGGCGGCTCGTGCTCGATTGACACGCT
GAAGCTGCGCGTGTGCGCCAACGTGCTGAACCTGCTGAAGCTCGGGCTTGGCGTGCCGCCCAGCGAGCGGTGTTGCCCGCTGCTGGCCGATCTGGCCGAC
CTGGACGCTGCGGTGTGCCTCTGCACCGCCATCAGGGCCAAGGTCCTCGGCGTCATCAAGCTCAATGTCCCCATCGACCTGGTGCTCCTGCTCAACCACT
GCCACAAGACCTGCCCGCCTGGCTTCACCTGCCCGCACTGATCGAACAAAGTACTCGGCCAAGCATGGCATGCTGCGTACACATGCCATGCATGCAGCCG
TCTATACACCACTCCAGTTTGTGTTTGAGTTCATCTATATGTCTTGTGCATGCCTAGGTTCTCTGTCATGCATTAGCATTATGCATGCATGCAGTGATCA
CTAGGTAGGTACGTAAACATAAGTGCATGAAAGTGTGTCAAGTTTGTGGTGTCCAAATAAATGACCCACGTAACCGGGGATTTGTATCATCATCTGAAAT
ACTGTACCGGGCGCCTATATGCCCCTAGCTTGTATCATCTGAAATCTGATGAAGTTGTGTAAACTCGAGATGTGTGTTACATATATATTGCCGCGTCATA
TTCCACTCCGAAAAAAAAAA
page-top