Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23716  (registered. 2003)
Contig Information
Length 1496 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 1
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 4
Wh_VSCB Liquid cultured tissue 3
Wh_VWD Shoot grown with dessication 4
Homology (BLAST) Top Hit MBD2 [Triticum aestivum]
Score 1590
Evalue 1.09972e-174
Total Hit Count 259
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23716
CGTCACGCAGGCGGACGGAGAAGGCTAGTCAGCCCTCTAATCCCCCAACCCATCCGCCGCCGCCGGCGGCGACCACCACCGGAGCTCTCAAATTCCTACC
GCCAGCCGCCCGTACCGGCCTCGATCTCTCCTCCGAGGCAATCTCTTGCAGAACCTATGGACAGTTCTAAATCTCCCCAACCATTGAAGAAGAGCCGTAC
TAGTTTGTCTGGTACGGATGGCCACCAATTTGAGAATGACGAGCTTCAGTCTGAAACTGCATCAGATAAAACACCTGGTTTGAAGTTTGAAACAGTAGAT
AAAGCGCAAGATGAATTTGGAGAAGACAGTTCCCCATTGCAGCAATCAGCTGCTTCCAATGTGGCATACCGTGGATCGCCATGTATTGGGGCATTCACTA
TCCAATGTGCTAGGTGCTTCAAATGGAGACTCATTCCAACGAAAGAGAAGTATGAAGAAATACGCGAGCATATTATACAGGAACCTTTTGACTGCGAAAG
AGCCCGTGAATGGAAACCTGATGTAACATGCGATGATCAAGAAGATATTTCTCAGGATGGAAGCAGACTCTGGGCTATCGACAAACCCAATATTGCACAG
CCTCCTGCTGGATGGGAAAGGCAGATTAGAATAAGAGGTGAAGGAGGCACCAAATTTGCTGATGTGTACTACACTTCTCCTACTGCGAGGAAACTGAGGT
CACTGGTTGAAGTTGATCGGTACCTCCAAGAAAATCCAGAGTATGGAGCGCAGGGTGTAACATTAGCTCAGTTTTCCTTCCAGATTCCTAGACCTCTGCG
GCAGAACTATGTCAAAAAGCGCCCTAAGAACGCAAGTCCAAGTGATGAAGCAACAACTAAGCCTCTTCAACCAGTGGAAGTTAACCCCATATCCTGGGCT
GCCCCTCTTGCAAGTGAGGCTAAGGCAAGTGAACCAGCTTCTCATGCCGACGAAAAGCCAGTTGGATCGGCAGATGTGGAGCTGGTCCGGAAGAGGAAAG
CAGAACCAGGAGAGTCAGATGCTAACAACCATGTGTCTGATGGGCCGGAAACCAAGCTAGAGGATGCTCAGAATGGAGATGCTACCACCACTGCCTGAAA
AGCTGCAGTCTGACGTACCCAGTGCTCCGCATCGATGATTTCCTCGACTCTCTATTCCTTCTCCATTGTATGCGGGAGCTGGTTTTTTCTGTAATGCGAG
TCCGTAATGGCCTTATATGTGTACCGAGGCACGAACCTTCGAGGTCGACCAAAATTCGACGATTTGGGACAGTAAGTTGACTGAATGTTGTAGTATCGGG
GAAGCCCTGTCGAACCCTTTCGGAGCATGTATGTTCCCCTACGTGCTTATGTAGGAGACCTTGTCGTGCAAGATTAGATGCCTTTTATTTTCTGCTTTGT
AAGATACAGAGATGTCGGTAGGGAACTGTTGTGTTGTGCTGTATGTCGGAGTCGACTCTTCTATTATCTATCGAGACATGCCAGTTGTAGCAAAAA
page-top