Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23715  (registered. 2003)
Contig Information
Length 1989 bp
Clones 19 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 2
Homology (BLAST) Top Hit Os06g0111500 [Oryza sativa (japonica cultivar-group)] >gi|19569141|gb|AAL92029.1|AF486280_1 cytosolic 6-phosphogluconate dehydrogenase [Oryza sativa] >gi|7363280|dbj|BAA93024.1| putative phosphogluconate dehydrogenase [Oryza sativa Japonica Group] >gi|113594626|dbj|BAF18500.1| Os06g0111500 [Oryza sativa (japonica cultivar-group)] >gi|125595798|gb|EAZ35578.1| hypothetical protein OsJ_019061 [Oryza sativa (japonica cultivar-group)] >gi|215686886|dbj|BAG89736.1| unnamed protein product [Oryza sativa Japonica Group]
Score 2325
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23715
CAACAAAACGGACATATCGGCACAACAAACAGAATGCAACACAACTTTGTGGTCAAAAGCACTACAGCAAGACCAGGAAGCATAAGTGGAAACACAGGCA
GGCATGTGAAAACGTATTTTATTTCTTCATGCTATATAAAATTCAGGATGGCGAAATCCGACAAATAACAGTGGTGGTTTCCCTCCAGGGTTGATCAATC
ACATGGAACTAGTGGAGAGAATACCGGCTGGACCTCCTTGTAGAAAATAAATACACCACAGACAGACTCATTACTCGAGTAATAAAAATTAAACGGCAGG
CAGTTCCTCCCCTACAGGAAAAAGGACTCAACAACAAAAGATATACCTACCGACAAGACGAAACCTGATGGGCCGTCTCTCAGCAGCAGCAGCAGCAGCA
GCAGCAGCAGCAGCAGCAGCAGCAGCTTAGATCTTCGAGTTGGCGATCTTGTACCACTCGGTGTGGAAGGATCCCGGCATGTCGACCCTCTCGTAGGTGT
GCGCCCCAAAGTAATCCCTCTGGGCCTGCACGAGGTTCGCGGGAAGCCTCTCCCTCCTGTACGAGTCAAAGTAGGCCAGGCTCGCCGACATGCCGGGGGT
GCTCACGCCGTTGTTGATGGCGAGGCACACGACCCTCCTCCATGCGGCCTGCCTGTCCATGATCTCCTGCGCAAACTCGGGGTCGATGAGGAGGTTCGCG
AGCTCGCCGTTCCTGTCGTACGCCTTCTTGATGCGGTCCAGGAAGCTGGCGCGGATGATGCACCCGCCCTTCCAGATCCTGGCCAGCTCGCCCAGGTTCA
GGCCCCATCCCTTCTCCACGCTCTTGGCCTTGATGATGTTCATGCCCTGGGCATAGCTGCAGATCTTGGAGGCATACAGAGCTTTCCTCACATCCTCGAT
GAGCTGCGCCTTGTCCACAGTTTCGCCGCTGCTGTAGTCACCTTGGAAGATCTTGGAAGCAGCCACCCTCTCGTCCTTCAACCCGCTGAGGAACCTGGAA
TCCAAGGACGCCTCAATGGTAGGAGCAGCCACTGAGAGCTCAGCAGCCTGCTGCACTGTCCACTTGCCGGTTCCCTTCATCCCAGTCTTGTCCAGGACCT
TGTCGACCAAGTAGCCTTCACCCTGGTCATCCTTGATGCTGAATATATCAGCAGTGATCTCGACCAAGAAACTGAGGAGCTCACCCTTGTTCCACTCGGC
GAAAACCTGCTGCAGCTCACCGTTTGTGAGCTTACCAACCGACTTGAGAACATCATATGCCTCAGCGATCAGCTGCATGTCACCGTACTCGATACCATTG
TGAACCATCTTGACAAAGTTTCCAGATCCACCCTTCCCAATGTATGTGACACACGGACCGCTGTCAGGGACTTGAGCAGACACCTTGAGAAGAATGTCTT
CAATGTACTGGTAAGCCTCCAGTGAGCCTCCAGGCATCATGGAGGGGCCATGGCGGGCACCCTCCTCTCCTCCGGAGACACCCATCCCTAAGTAGAGGAG
TCCACGCTCCTCCATGGCCTTCTCCCTCCTTTCTGTGTTCTCATACCACTCGTTTCCTCCGTCAACGATGCAGTCACCTTGCTCCAGGTGTGCTGCGAGC
GTTGCGATGGTCTGGTCGACCGGAGCACCAGCCTTGACAAGCATGATGACGACACGTGGCTTCTGAATGGAGTTGACAAAGGATGCAGGGTCATGGAAAC
CATAGAGAGGAAGGTTTCCTTCTAGCTTGGCACGCTGAACAGTCTCATCGACCTTGGACGTTGTCCTGTTGTAGACAGAGATGGGGAAGCCTTTCTCGGC
AATGTTGAGGGCAAGGTTCTGGCCCATGACCGCGAGGCCAGCGAGACCAATTCTGGTGAGAGCCATCTCGTACCTGACCTGACCTGCCTTGGCTTGGATG
GATGAGATCTGCGTGCGTGCGTCGAGGAACGAACAAGGAAGGAAGGAAGGCAGGCGAGTGTTTGGTTGGTGTGCGGTGCGATGCGACGC
page-top