Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23709  (registered. 2003)
Contig Information
Length 462 bp
Clones 19 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_SHC Shoot grown with cold treatment 15
Homology (BLAST) Top Hit putative proteinase inhibitor [Hordeum vulgare subsp. vulgare]
Score 300
Evalue 4.8157e-26
Total Hit Count 224
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23709
CCTCGTGCCGAATTCGGCACGAGGCTCACGGAAGCGAGGATGAGCTGTGCCGCCCCCGGAGAGGAGAAGAAGACGTCATGGCCTGAGGTAGTGGGAAAGT
CCATCGAGGAGGCCAAGGAGATCATCCTTAAGGACATGCCTGACGCCGACATCGATGTCCTTCCTGCTGGCTCGGCGATGACCCTCGACTTCAGGACCAA
CCGTGTCCGCATCATCGTTGACACTGTCGCGACCACCCCTTCCATTGGTTAGCAAGCTTTGCGAGCGAGAGACAAATTGGATGCACTTATGCATGCGGAT
GAATAAGTAGTTTCAATAATCATGAATGAATAAATACACGCTGACCAATGGCGTGTGTCGATGTACTTATGGTTCAATGGACTCCAGTTATTTTAATTTA
TGAGATGTCGGCTCGTTGTCCATGTGTTTACTAAAATGCTCATGAAATATGCAAAAAAAAAA
page-top