Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23691  (registered. 2003)
Contig Information
Length 1262 bp
Clones 19 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 5
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 5
Wh_VWD Shoot grown with dessication 4
Homology (BLAST) Top Hit hypothetical protein OsJ_007398 [Oryza sativa (japonica cultivar-group)]
Score 379
Evalue 2.30156e-34
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23691
TTTTTTTTTTGATGCTGTAACCTGAAATTGATCGTATAACGGACATTCAACACACTATCAATTTATCAGTATCAAAGGAATGGAATCCCTTTTACGAGTT
GCAATAATATCAGCAATAGCTCAGTTCAGGCAATTGAAACAACAGGGAGGAGATACCAAGTTGACCTGTTGTATTAGGAATCATCAAAACTTAGATCTAA
CAACAAACAACATAGCCACCGGACTCAGAAAAAGGTTTCACCTTCGTGGCCACCCCTCATACCGCGGAGGGCTCCTCCATATCCCTGTCCCTGCCACGGC
CGTTGGCGCCGGCGCCCCCACCGTGGTGAGGCGGGTCAACGGCACTGAGGCCCTCAGGCATGAGGGAGGCCGGGCGGTTCTCGATGACCTCGTCTATAAG
CCCCCATTCGCGCGCCTCCTCGGGGTCCATGAAAAGGTCACGCTCCATGCACTGCTCGATCTTGTCGATGTTCTGACCCGTGTGCTTGGCGTAGATCTTG
TTGAGGCGGTCGCGCAGCTTGAGGATCTCCTTGGCCTGGATGGCGATGTCGGTCTGCCTGAGCTCACTACCACTACTATTGCTAGCTTGATCGAGATGGC
CCGTTCTGCTGTTGCTCAGGTCGTGCTCGTCGCCGTGGTGGCCGCTATGCTCCTCGCAGTCACGGAGGCGGCTGTATCGTGCGGTCAGGTGAGCTCTGCC
TTGAGCCCCTGCATCTCCTATGCACGCGGCAACGGCGCCAGCCCGTCTGCGGCCTGCTGCAGCGGCGTTAGGAGTCTAGCCAGCTCAGCCCGGAGCACCG
CTGACAAGCAAGCGGCGTGCAAGTGTATCAAGAGCGCTGCTGCTGGGCTCAACGCTGGCAAGGCCGCCGGCATCCCCACAAAGTGCGGCGTTAGCGTCCC
CTACGCCATCAGCTCTTCGGTCGACTGCTCTAAGATTCGCTGATCGAGCACTTGCTGCCATCGTTGTTGCTATCGTACGTCCCCTACGCCATCGTTGCTG
GATCTACGCTTAGTACGTTGAGGTCACACACACGCACACACATATATATATGAATAAATGCTCTCATATTATCTCACTGCGTGAGAGAGAGAGGAGTACG
TCCGTCCAAGCAGCTCTGTATGGCCGGCCACACTGTTGTATCGATGTTTGGTTGTTCCTCCACTCCCCGAGTTTGCTGTACTTTTGATATATGGATTGTA
TACACAGCTGATCAGCTCTACTTGCGTGTGCATGTTATTCAGCACTTTTGATAAAAAAAAAA
page-top