Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23667  (registered. 2003)
Contig Information
Length 739 bp
Clones 19 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 3
Homology (BLAST) Top Hit Os07g0680300 [Oryza sativa (japonica cultivar-group)] >gi|113612180|dbj|BAF22558.1| Os07g0680300 [Oryza sativa (japonica cultivar-group)] >gi|218200264|gb|EEC82691.1| hypothetical protein OsI_27348 [Oryza sativa Indica Group]
Score 242
Evalue 7.46491e-19
Total Hit Count 13
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23667
TTTTTTTTTTGGAAATAAACACGAGCACAGTTTCTTTTCTCTGTGACGGCAAATAAAATTTACATGATCATTCCCCTCCCATGGTGAGGGTTACATGCAA
CGCAAGAGGAAACCTACATCTGGATGGCAAATCAAACAAGGGAACACGAGGGTCTTGTATATTATTGGCTGGGTCATCCAAACTCAGAGAATCGTCCTGA
AAATGTACGCATCAAAAGTTGCAATGTATGACACTCATGCCTCTGGCTCGGGCTTCTCAAAGAAGGTCTTCTTGATCCAGTCGAATGGCTGGACGAGGTA
GATGGCGGCGCTGCCGGCGAAGACGCCCCAGGTGGCGAGGGCGGTGACGTCCGTGGGCTGGATGCGGCGGGAGGAGAGGAAGCGGGAGAGGGTGGAGCCG
GACGCCGGGAGAGCCATCGCCGCCGCTGATTCGCGTCTCGCTGCTTTTCTCTCTCTCTCTTCTCGTTTTTTTTTTCATTAATAGGANCTAAANATTATTG
CTGATATATGTTCANTACCAAACATTATCATTATTGGCTTGCAAGCTCAAGTCAGGGGGGGAGGAAAACANTANCANCTGCTCCACCACAAAATTACTAN
CATANTACACNCNTAATAAACNCAGGANAAAAAAGGANTCTCTTCATCTTCNCTGTCTTCCTCCNCACCNANAGGANCCACNTCANNATTTTTCTTANGC
NGACTTCNCNNNGNCNNCNTTNATNATNNCNNTNAACTC
page-top