Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23661  (registered. 2003)
Contig Information
Length 970 bp
Clones 19 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 5
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 5
Wh_OKCS Seed DPA5 2
Homology (BLAST) Top Hit Os04g0605900 [Oryza sativa (japonica cultivar-group)] >gi|113565368|dbj|BAF15711.1| Os04g0605900 [Oryza sativa (japonica cultivar-group)] >gi|215707011|dbj|BAG93471.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218195518|gb|EEC77945.1| hypothetical protein OsI_17293 [Oryza sativa Indica Group]
Score 1013
Evalue 4.73916e-108
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23661
TTTTTTTTTTCGAGGCACATAGCAGGAGGCATTAAACACGGTCTCAAAACCTCCACATACAGAGTCAGATTCTTCCAAACATGCATATCATGGTTCCGAA
ATATCAAAACTGCATCCACCATCCACTTCCTAATGTAAAGCAGGCTTAACAAACAAAACATCTTCCGAATACAAGAGATCATCGATGATCAACCTAGTTC
ATCCTCCTGACGAGCTGGTTGATGTAGTTCTCGCGGTTGCCGGCGTCGCCACCCTCGACGTAGTGGTTCCTCTTCTTCTTGAGGCCTCCCAGCGGCGCCT
TCAGCTTGAAGGGCCACAGGAAGTTGTTGGCCTCCTTGAAGTGAGGACCGACGGTCAAGATCTCATGCACAAGGTCCTCAATGCAGATGATGTTGTGCTT
TCCAAGACCCTCCTCGATGACCTTGTTGTTGGTCAAAGGAATCCTTTGCTTGTTGAGCTTGCCATAACCTCTTTTGTAGATCAACTCCCTCACACTCTTC
AGGTTCGGGTACCCATATGCAACATATGGCTCGACCCTGCGGAGCATGTTGATGGTGGCCTTGTTAACCTTCAGGAACACTCCATTGAATATCTGTCTCA
AACGCAACAGCTGCAAGATCTTCTTGGTCTTTGGGTGCATGGCATTGATACCTCTGATTCTGACAACAAACAGCAGCTTAGCCTCAGGACTGACATAGAA
CCCACCCTTCATCCGGGCCTCACGCTTAAGCTGAACCAACTCCTTGTCCTGGGCATCGTACTCCTCGGCGTACTGCTTGGCGCGGGCGTAGATGACCTTG
ACGTTCTCGCTGGATTTCTTCTTCTCCTCGACGGCCTTGGTCTTCTTCTCGGCGGCCCAGAGCTCCTCCCGCTTCCTCTTGAGGAGCACCGACTCCGGCA
CCACCACCTTCGCCGCCTCGGACGACATCTCGACGAGCTTCCTGCAGGGGGAGGGAGGAGGCGAGAGAGA
page-top