Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7708  (registered. 2012)
Contig Information
Length 1053 bp
Clones alternative view 23 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_r Root 2
Wh_OKCS Seed DPA5 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VHS Shoot with heat shock treatment 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 5
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|162462805|ref|NP_001105764.1|| adenosine 5'-phosphosulfate reductase-like1 [Zea mays]
Score 494
Evalue 5.00E-138
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7708
TTTTTTTTTTCAAAACTAGTACTCTTATTTGAACTTCCTTACAATCATCTAGCTACAACTACACACAAATCCCCACCCCATTATAATGGAGGGGCTTTGA
GCCGCTGTCCCCGCCTCCCCACACTCCTTTGTCTCCAACATTTCCGTTGATGTTCTGAACCATCCTCTCTTGCTACCACTACATAATAGTGCCTAGACAC
CGCCGGTACCAATGCAGAGAACGATGGTTCTCCGGTTCTCTGACCACTCATCTGAGGCTGTTCACGAAGGCGAGGAGGGATTGGACGTCCCTCTTCTCGG
ACGGGTACTTGATAGGCTTCACGGTGCGGCCGGGGAAGAGGAGGATCGTCGGGAAGCTCTGTAGCTGCAGCTCCGCCTGCGCGAATGGCTTCTGCTCGCC
GTCTGCGCGGAACTTGGCCACCTTGATGCCTGAGCCGCTCAGCTTCTCGGCCAGCTCAACGTAGGACGCCTCCATCGCCTGGCAGTATGGGCACCAGGGA
GCGTAGAGGACGGTGAGCCACGGCTCGGCGCGGTTCTCGAGCCGCAGGAGGTTCTCGATCCCGGGACGGGTGAGGTTGACGATGGCCTGGCTCTGGAAGA
TGTCTGGGGCGCGGGCCTCGGCCGAGCCATTGCCGTTAACGCCGACCTTGGGTGCCTGATCTTCCCTGTCGATGTTACCCTTGTGGAGGCCGCACTCCTT
GGCCGTGGCGTCCTCCCACCACCACCTCCCTTCCCTCTCGTGCTGCCCCGGCAACACGGGCCTGGTGCACGGCTCGCACCCAATGGAGACGTAGCCTTGA
GCATGCAGGGTGTTCACAGGGACATCCATGGTCCTGAGGAAGGTCCAGATATCCTTGCCATCGACATTAGCCACAGGGTTCCACTTGATCAAGCTACCGG
CTCCACCGTGCAGCCCTTCAAAAGACGGATCAACCTGAACAACAGGGATGCTGGCCCTGGTGCCAGGGGACTGGTCCTTCCTCTGCCCGGTGATCCAGGC
CTTGAGGCCCTTGAGGGCCCTCCTCAAGGGCCGAACCTTCCTCACCCTGCAGC
page-top