Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23620  (registered. 2003)
Contig Information
Length 1361 bp
Clones 19 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 6
Wh_EM Dormant seed with water absorption 1
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_KMP Shoot grown under continuous light 2
Wh_RDr Root of dessiccated seed 4
Homology (BLAST) Top Hit H0525D09.11 [Oryza sativa (indica cultivar-group)] >gi|125548758|gb|EAY94580.1| hypothetical protein OsI_16357 [Oryza sativa Indica Group]
Score 1569
Evalue 2.64057e-172
Total Hit Count 364
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23620
TTTTTTTTTTGAAGCCAAATGGCGTTATTCCTTAAACTCTCCAAGTCACAGACCAATACACCAACAACCCTATCACACTCCGGTATACCATACCATTTCG
GCTCAGAAAAGACTAGGAACAGGAGGAAAGGAAGTTCGGTATGGTGGTAAAGACAGCATGGGTGTAAGATATACAGAGGTATATTTCTTCAAGCTCAGCC
GTCTGTCGGGGAAGAGCTCAGGGCAGGGAGGCGAAGGAAGGTAGCAGCCAGCCGCGCTCTGTCGCGAGCTCCACATAGCCTCTGAACTTCTCCTGCGCGT
TCGGGATGTCAAGGGTCAGATCATCGAGGCCTTCCTTGACACGGGCGAAGCCGTTGGTCATCTGGTTGATGGTTATCAGCCCCTCGCTGGAGCACTCCTG
CAGCAGAGCCAAGATGCTAGCTTCATTCTGCTTCTCCATCGCCATCACCAGCGCTTTCTTCACCACTTCATGGTTGAAGAAGGGCATCCCAAGGTCACGG
ATGCACTGGCAGGCCTCCTTCAGGTCGCCGCCGGTGTTGTACTCCTCAAGGAGCTTGGAGATCTTGTCTTTTGCATCTTCCACAGCCCAGCCAGTGCCCC
CACCCCAGCAGCGCAGTATCCTCTCACCAGAATGGCGGGCCGCAAGCAGAGAGCTGGCCATCTGGACAGTTTGACTACCACTGCTGTTTGGCCGCAGCTT
GCTACCGATGTCATCCAAATTCAGTGGAAGCAAGACTTCATCGATCACTGCCCTGGCGAGGAAGAGGGCGAGTTCACTAGGAGCATCCACAATGTCGAGG
GCAGTGTCTTCTGCTGACTGCAGGAGCATTATGAATCCCTTCATGATATCACCTGCGGAAAATAGTTCCAAGCTGAGTGAAGAAAGAAGTACAGATGCCA
TCTCCTTCTCCCTGTTCTTCCTGTCCATAGCAAGCGTGATGAGCTTCTTAAGGAAAATGGCGTTGTATTCAGGGGCAGAAAGCTCTTCAAGGCTTCTAAT
GAGTTCCGGGACGTCATCTGAGAGGAAATACTCCTGAATTATGTGACCAGACTCTTCTTTAAAACGCTTGACCTTTTCACTGCTTGCATTCCACATATCT
TCATCAGGGGCAGCAGACTTACAGAATGAAGCATCAAGCCACCCTTCAGACATGGCTGTGGAAAGCAGCTTGTCAAAAAGTGCTTTGGCTGAAGGAACAT
CAAGGCTCAGGTCATCAACACAGTCAGCAACCCGAGAAAAGCCCTTCGACACTTGATTAGAACTGATCAAACAACCCGTCGTTGATTCCTTCAACAACTT
CAGGATTAATGGCTGTGACGACAGATTCTCCATACCAAGGATGAGAGCACGTTTCACAACC
page-top