Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23600  (registered. 2003)
Contig Information
Length 2254 bp
Clones 18 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 5
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 2
Homology (BLAST) Top Hit unknown [Picea sitchensis]
Score 1123
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23600
TCAACCAAACCAACAGCACAGCATATGAAACCATCACCCACTTATTAAAGTATCCTATATGGAGTACTTCGTTCATTCAATTTTTACGGTTATGTTTCGC
CCAGGGAGCATCAACAAGCGAATGCTCAGGCTTTGGGTAGTCCGTTCTCTGCTTTTGTCACGGAAGCACGTGGAGGCCATGGCGCGCCAGCCATTACCGC
TTCGATTTCCCAGGTCTCCCGGGGGCAGTTTGTCAGGTTCTTGCATCCTTGTGCCGTCACATACAGATCACTTTCAATACGAACACCACCAAAACTTTTG
TACTTCTCAATCTCTTCCCAGTTGAAGAATTTTGAGGAAATTGGATCATCCCTGGCAGGCCTCAGCAAAGCATCGATGAAATAACAGCCTGGCTCAACCG
TAATAACCATGCCTTCTTTAAGTTCTCTTATGGTCCGCAAGGAGCTCAGTCCTGGCTCCTTTGGTCTCTCTAAGCCCTCAGGGTAGCCTCCGGGATCATG
GGTGTCAATTCCAAGCAAGTGCCCAAGACCATGAGGCATGAAAACAGCACCCAACCTTCGAGCCATCATATCAGCAATATCACCATGGATAATCTTTTCA
TTCTTGAGAGATTCAAGTATTGTCTGCTCGGCCAGCTTGTGCATATCAACCCATTTTAATCCAGGCTGCATGTGTGATATGACAGCATTATGAGCCTTAA
GGACAGCATTGTATACTATTGCCTGGTTGCTGTTGAACTTCCCATTTATGGGGTATGAACATGTGATGTCAGAGCCATAGAAATTATATTCAGCTCCCAT
GTCCATTAGAGCCATGTCTCCATCATTCAGCGTCCGGTCATTTGGAGCAGCCGTATGTCCATAATGAAGAATAGAACTGTTCTCTCCGGTAGCGCATATG
CATGTGTAGGAGCAATGTCGACAGGCTCCATACCTATAAGAATGATGAAGAAATATGCTTTCTAACTGATATTCCTTCATGCCTGGTTTTGCCTGTCTCA
TAACCTCAATGTGTGGCTTCTGAGCTAACATCATTGGCATATTGAATGAGGGCAAGCTCCATTCCAGATTTGATAACACGGCATTCAGTTAAGATAGGGT
GGAGTGTACTCAAATCGGTGTCAAACTTCTCTATCCCTTCAAAACTAGCAGGCTTTGAGTAATTTCCGCTGTCAGTACTCTTTCCATACAAGAGAAACAA
CACAGGCTTCCCATGCTGACTGAATCGATCTTGCAGAACCTGCACAATCTCATCGACATAGAAGACCAAATCGACCTTGTACCTATCCTTAAAATAAGGG
AGTGGTTTTATTTCACCCATCCAGACAGCATAGTCAGGTGGCAACCTTGGAGCAAACAAAATCGATTGTCCAGAGGCAATGTCTATAGCGCCGTAGAACC
CTGGCTCACGCACTCCGAAGAGATAAGCAAAGTAGCTCTCCTGCCTAAACAGCTCGAGATGATCAGTGCAGTGTCGTGTCTGCTCCTCACCGCCCTGGAG
GAGGGCAAGGCCGCGGGGAGGGCTAGCGGCGGCGGAGAGGTGGGCGTGCAGTGCGGTTAAGAGGCGGTCACGGTTGCCTGCATGCAGCTCCATGGGCACC
TCAGGCGGAGCAAGAGAGGAGGTCGCCATTGCTGGATACTGTTTTCTATTCACATGAAGAGTTTGCCATCTTGAGTTTAGCATGAACGCATCCGGCAAAA
ATCGGTGCAGATGGGGGAGAGGAACTGCCGGTGGCGCGAATCGAGGGAGGAGAGGGACGAGGGGAGGCGGCGCACCAGAGAGGAGAGGGCGAGAGGGGAT
GGGGTTGCGAATTGCATAGATCATGAGTTCACTCACAATAGTACTCTTCTGAGCACCAAACAGTTCATGGGAATTTAAGCACAACAAATTACAAGCAGAT
TGACACAATAATGTGGGAGACTTGCCGGTGTTGCAAACTTCAAGTGGCAGCGACCGTGGGGGGAGGGAACAGGGTTATCTCCACATTGTCATGAACACCC
TGCAGAAGCATTTCACCGTCGTAGGTGACAACTTTCCTCTTCTTGGCGGCCCGCAAGGTGCCAACTAATGCTTCAAATATGTTTGCGCATCGGTCGTCAT
TGAAGATGACACCAAACTTGACCTTGTAGGAGCCGTCGGGCTGCTGCTGGCCGAGCCTCTGGATCTCCTCCCGGAGCTTCCCGACCTCCTCCTCGACGTG
CCCAAGGTTCATGGCGCCGCTTCTTCCTGTGATGCTTCTGGATCTGGCGCCGCG
page-top