Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig77  (registered. 2012)
Contig Information
Length 901 bp
Clones alternative view 48 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 14
Wh_KMP Shoot grown under continuous light 4
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 18
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig77
CGTCCCTTTGAGAGTCGCTCCAGGCACCCCGGCCCGATCTCGAGCTTCGTCCGTCGGCGATGCCGATCGACGATGGCTTGGGAGAGGCACCCGGGAGATG
CTTGTATATACTGGTTTAGTTCAGGTCGTCTTGTGGTTTGGCGCTATGCCGTTGGGGTTTCTACCGCCGGTGCTTGCGAGCAGCTGCCGGTGGTTGCCGT
TCTTGTCTTCTTCTTCGTCTCCATGGTGGAGGAAGGGAGGAGGCGCTGGATCTGGCGAAATCCCTCTCAATAAGCTCGCGGGTCTCTCAGATCTGGAGCT
CAAGCTCCTTCTTCCTTACTTCTCCTCGAGCTGCCATGGAGGTGGATTGGAAGAAGAGGAAGAAAGGGGATTTGGCTGCTCTATCCTCTCTGCGTGTCCT
TGGAGCCCAAGTTCTGCAGCAAATGGTTGGGGATCTTGGTGCAGAGAGCACCAGGAGTTTCTTGCCACTGCACCGCTGTATCTGCTGGTCGAAAGGCGAC
CACTCGGAGTTCTGGCGACGACGTCCGGCTCCTGTATTTCCTCCTGGCCGCCGAGCCATATGGGAGGCAGTTTATCTGGTTCTTTGTCCTGGTATTTCCA
TGGTCTACCTCCGGTTGTTTGCCGGCGGTGTTGTAGCCATTCCTTCACCCCAAGTGGTTTCGTCCCCGGTGGTGGTGGGATCGGGCCAGGATCGAAGACG
GCGAAGAGGACTCGATTGCTTTTCATTTTTGTTGTCTGGGGTCCTATCTGCAAAATGTCCGGCCTGGGTTGTAATTTTCTCTTTCTGTTGGGCCTTTCTG
TAATATGTTGCATGCTTATCTAGTATAAGTCTGGGTCCTTCGGGGCCCTTCTTGTGTTCAAAAATAATAATAAAAAATGGATACTTGGTCTAAAAAAAAA
A
page-top