Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7698  (registered. 2012)
Contig Information
Length 1309 bp
Clones alternative view 73 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 6
Wh_e Seed DPA10 5
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 3
Wh_r Root 4
Wh_CSEC Callus 4
Wh_DPA20 Seed DPA20 5
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 10
Wh_PCDAM Anther at meiosis 1
Wh_SHC Shoot grown with cold treatment 1
Wh_VHS Shoot with heat shock treatment 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
WH_SP 5
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|49343245|gb|AAT64932.1|| cytosolic malate dehydrogenase [Triticum aestivum]
Score 655
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7698
TTTTTTTTTTAATCAGGTGTCAAATTGTTTCATCCTTCCAGCAAATGTACTGTCCTGTAAATCATCAGGCAAAAGGGGAGCTACAAGCCTCATTCATACA
CACTGGGAAAACCAGCGAAAAGGAGCATGCATCGCGATGTGCGGCTGTTCTGGGTAGAGACGAGAGTTTCTAAGGAGCGGAAGGTTTCATTTATTCAAAA
CATCCAGAGGAGCAGCTGCCCTTCCAATGTGGATTTACGCGAGGCATGAGTAGGCCAGCGCCTTCTCCTCGGACAGCTCCTGGGCGGTCGCATCCATCTT
CTTCCTCGAGAACTCATCGATCGGGAGCCCTTGAACAATTGTCCATTCACCACCACTGCACGTTACTGGGAAGGAGTAGATAAGACCAGCAGGCACACCG
TATGAACCATCAGAGTACACACCCATGGAAACAAATGTTCCCTCGGCGGTTCCCAGAACCCAGTCACGGATGTGATCACAAGCTGAGCTGGCAGCAGAGA
GAGCACTGGAGAGCTTCCTCGCTTTGATGATTGCGGCACCACGCTGCTGGACAGTGGCAATGAACTCCCCATTTAGCCATTCATCATCTTGAACAAGTTC
ACGGACAGGCTTCTCTCCACTGGGAGTCTTCACAGTGGCGTGGTTAACATCAGGGTACTGACTGGACGAGTGATTACCCCAGATAATAGCATTCTTCACG
TCAGAAACTTGGACACCAAGTCTCTCAGAAATCTGACCGAGTGCCCTGTTGTGGTCTAGGCGGGTCAAACAACTGATGTTCTTCTCAGGGATAGATGGAG
CAAACTCCTTCAGGATGAGAGCATTGGTGTTTGCTGGGTTGGCAACAACCAGAACCTTGCAATTGGGGGCTGCATGAGCTTCAAGAGCAGATGCTTGAGC
TTTGTAGATTGAAACATTTTTCGTCATAACATCCTTCCTTTCCATTCCTTCCTTCCTGGGGAATCCACCAACCATAACCGCAACATTCACACCAGTGCAG
GCCTCAACAACATCAGTTGTTGCAACAACTCCCTTGAGAAGTGGAAATGCGGCATCAATCAACTCCATCTTGACACCTTTAAGAGCTTCAGCAGCAAATT
CAATATCCAGCATATGCAGAATAACAGGCTGGTCTGCACCAAGCATAACTCCCCTGGCAATCATGGGAACAAGAGCATATCCGATTTGTCCTGCGGCGCC
GGTGACGAGCACGCGCATCGGTTCCTTCGCCGCCATTGGAGCCGGGGTTAGCTTCTGGAAACGGGGATAGGGAGAGTGGTTTAGGAGGAGGCGACGACAA
CGGGAAAGA
page-top