Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23502  (registered. 2003)
Contig Information
Length 1245 bp
Clones 18 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 6
Wh_V483 Shoot grown under cold condition for 3days 10
Wh_VHS Shoot with heat shock treatment 2
Homology (BLAST) Top Hit galactinol synthase [Triticum aestivum]
Score 1659
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23502
TTTTTTTTTTCAATCAAGAAAAGAACACTGTATATATATGATCCATTGATGATCTACAATACCAAAACATGCAGATACTGAATCGACGACGATATTACGT
ACTGAGGAAATCCCTAATTTTGGATATATTCCTATTTATTAAGGACCATTACACGCCTTTTTGCAGCGAGCGAGCCTATGCAGCCGAGGGCGCCGGGAAG
GACTTGACGGCGACGACCTCGGCGAGGGCAGCACGCAGCGGGTCGGCGGCAGGCTTGTAGTTGAGGCTCTCGTCGTCGTAGATGGCCCACCATTTCTTGA
CCAGCATCTTGATGTCCTCCCTGTCCATGTTGGCCTCCTCGCCGGTGTACCTCCACGGCTTCGAACCCGCTGCACAGTAGTGGACGACCTTGACCTTGTG
GAGCTGGATGTTCTCGGGGTGCCTCCAGAGCATGGCCAAGACGAGGTTGTAGACGGGCGGAATGGGCGTGTACACGTCCCTGAAGAACATGTTGAGGAAG
TCCTGCTCGGCGAAGGGGGTGGGGTCGGTGACGACGAGCTTGTCGAGCAGGGCCTTGGCGGTGGCCATGCTGGGCTCGTGCACGAACATGCCGGCGTTGA
AGTAGAGCGGCGGCGGGGGCACGCCGAGGTCGCGCTCCGGCCAGACGACCCTGTCGGGGCACTGCTGGCAGTAGCCGATCTCGTACTGCTTGGTGTGGCT
CCACGTCTTCTCGCAGAAGCAGTCCTTGACGGCGTAGAAGCTGCCCTTCTCGAGGTCGAAGAGGTGGTCGACGTTGTCGTACACCTGGATGTCCGCGTCC
AGGTACACCATCCTCTCGTACTCCACGAACTCCCAGATGCGGAGCTTGGAGTAGTTGATGACGTAGTATGCCATGGCGAACTGGGTCTGGCTCTCCGGCG
GGTAGACGGGCACGATCTCGCGGACGAGGCAGCCCTGGGCGAGCAGCTTCTGGCGGTGGTCCTCGGGGACGTCGGGGAGCACGGCCACCACGAGCGGGTA
GGCCGACTTGACGGCGCGGAGGCCCTTGGCCAGGCCCACCACGCCCTTCCAGTAGTCGCCGGAGCCGGCGAGGAAGGTCACGTACGCCGCCTTCTTGGGC
TCGTCCTCGGCGATCCGCTTGAGCATGGGAGCCATTGTTTCTCTTGTCTTGCTTCAACTCAAAGGATGGATGGGATGTGTGTTGTGGACGGATGATCCTT
ACATCTATGCTTTCGACAGCCTGAAGTCTGGGTTGGCAATCATAG
page-top