Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23498  (registered. 2003)
Contig Information
Length 1470 bp
Clones 18 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 3
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 1
Wh_PCDAM Anther at meiosis 3
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit hypothetical protein OsI_18577 [Oryza sativa Indica Group]
Score 1233
Evalue 2.67923e-133
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23498
TTCTGAAGGAAATAGCACAGGTATAGCATTTCTGCAAAACTCATGATAGCAACCTACACCGAATATCTTCTTGACATGAATAAAGACCCAACCCAGACTA
CAGTTCAGAGAGCAAATCCTACTCATAAGAGCACCATAGATTTGAACTGGTTGTGCAGGCAGATAACCCAAACACCCTAGTAACCACCCTTGAGATCATT
GACCACATCGTAGGGAATGGGAGTGACAGTCTCAATTGTGGTACCCTCGACCATGAACCCAGGTTTAGGGCCGAGCGGCTGCCTCTTGGTGCTGATGACC
TCACCGCGCGCCTTGGCTTCCGCCTTGAGCTGGTCGTTCTTCACTTTCCTCAGGCGGAACTCCTCAGCACACCTGGATGGCTGCACATGCTCAACACGGA
CATGGATCCTTTTCCTGATAATGCGGTTTCCAACCTGCTTGTTGATCTCAACGCCGATGGCGCGCTTGGTGACGTTCCACACGCGTCCGGTGCGGCCGTG
GTAGAACTTGTGCGGCATACCCTTGTGCACGGCGCCGTTCACCTTGACGTCGACCCTCGTGCCGAATTCGGCACGAGGACTTTTACAGCACCGTGTTTGA
AGGAGGCTTACAACACAAAGTATTACTAGTCTTGAGAGACGGAGAACAACATACAACATGTCACGTCAAAGTTTACAGATCACAGAGATCTCCATCCAAA
ACTGAGCGGATCTCATTGCAGGTTTCGATATGCTAGCATAGGGGCGAAGGGGCGTGCTACGGTGGCTACGACTACGAGAAGGTGTCCTCCCTGTCCCCCT
CAGCGACCTCGCCCTCCTCAATGTTGCTGAACTCCAGGAAGTGCGTCGGCCTGTGGTCCTCATGGTAGAAGTCGCGGGGTGTGCCCAGCTTCATGCTGTA
CTTCATCAGCGGGTCGTGCTTGACTCCCATGAAGTTGTAGTTCCACGGAGCGTTGTCCGGAACCATGTAGAATCCAAGGAAGCGGTCGCTGAGAAGCATC
TGGACCTTCTCGTAGTGAGTTGGGAGGTACCCTTGTGGGTTGCTCCCGTTGTCCTTGTTGCCACGGGCCCACTCATAACCACTTGGTGTCAATTTGTACG
CAGTCAACGAGCACGATCCTGGGGTGAAGCTGCAGGTCAAAATGATGCACTTCTCACCATCCCACTGCTTGTTGTTCTCCAAAATTTTAGCATGTGATGT
CAAATCCTGAGGTGATAGCTGAGGAGCTTCATTCGGCTGGGTATGCATCCATCCCAACGGCTCCAAGTCAGCAAGGAACTCATGCTCTGGGAGATTCGAT
GGCAAAGTCACCATCTGGTGAGTTCCATGCTGTGGCGGAATGGATATGCATCTGATCTCCTTGACTTGGGGATTATCCTGTGGACTCAGCCCATACAGGA
AACCTGCAACCTGTGTCCGTAGATCTGCTATGCATATGAACTTCTTCAATATGTTCTTTGGCATGATGTA
page-top