Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23489  (registered. 2003)
Contig Information
Length 699 bp
Clones 18 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 18
Homology (BLAST) Top Hit RecName: Full=Alpha-amylase/trypsin inhibitor CM3; AltName: Full=Chloroform/methanol-soluble protein CM3; Flags: Precursor >gi|100834|pir||S16031 alpha-amylase inhibitor, tetrameric, chain CM3 precursor - durum wheat >gi|21713|emb|CAA35597.1| unnamed protein product [Triticum aestivum] >gi|21922|emb|CAA43367.1| CM3 protein [Triticum turgidum subsp. durum] >gi|38098487|gb|AAR10959.1| alpha amylase inhibitor protein [Triticum aestivum] >gi|39578552|gb|AAR28678.1| alpha amylase inhibitor CM3 [Triticum turgidum subsp. durum]
Score 766
Evalue 1.13599e-79
Total Hit Count 342
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23489
GCGAACCAGACTTGGNTAGAATACCATGGCGTGCAAGTCCAGCTGCAGCCTCCTCCTCTTGGCCGCCGTCCTGCTCTCCGTCTTGGCCGCTGCTTCCGCC
TCCGGCAGCTGCGTCCCAGGGGTGGCTTTTCGGACCAATCTTCTGCCACACTGCCGCGACTATGTGTTACAACAAACTTGTGGCACCTTCACCCCTGGGT
CAAAGTTACCCGAATGGATGACATCTGCGTCGATATACTCCCCTGGGAAACCGTACCTCGCCAAGTTGTATTGCTGCCAGGAGCTCGCAGAAATTTCTCA
GCAGTGCCGGTGCGAGGCGCTGCGCTACTTCATAGCGTTGCCGGTACCGTCTCAGCCTGTGGACCCGAGGTCCGGCAATGTTGGTGAGAGCGGCCTCATC
GATCTGCCCGGATGCCCCAGGGAGATGCAATGGGACTTCGTCAGATTACTCGTCGCCCCGGGGCAGTGCAACTTGGCGACCATTCACAATGTTCGATACT
GCCCCGCCGTGGAACAGCCTCTGTGGATCTAGAGATAAAATCAGTCGCTCGTGAATAAGCATGCATGTTGCATCCATAGGCGTGTGGTGTGCATGTATAC
ATATGTGAGCTCCGCGCGCTCAACATGTGTGGGCTATCTGCTATGAATGAGAATAAAGAGAATCATTCTGTGGTTCTTTAATTTCAACTAAAAAAAAAA
page-top