Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23482  (registered. 2003)
Contig Information
Length 1546 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 10
Wh_VWD Shoot grown with dessication 1
Homology (BLAST) Top Hit glutamine-dependent asparagine synthetase [Triticum aestivum]
Score 1358
Evalue 2.75487e-158
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23482
CGTACAGGTAACCACCCTTTCGATTTTGATCGTGGTGCATGCTGCAAACGAATAAGATCGTTCAAACTCCCAAGCCATTGAGCTTCCCTAACTAGTCACA
CCAGAAAGGATGTATGTATACAAGTCTTGGTATACAAAAAATCCATCAAGAACTGATCAAGGCGTCCCTCCTACAGTGCCTCGAACGACTGTTATGTGAC
GAGTGTTCGTTCTATGGCCTTCCTCTCCGGAAAGAAACTGCGTCTCAGGGCTTCAGCCTCGCGATCCATCAAGCTTAAAACCACCTTTCAGGCACCTTGT
CTCGATTCCCACCACAGTTCCTCCCGGGGTAAGCATGGAGGACTTCGTCGAACCTTCCGGATCGAGCCCAATGGCCCATTTTCATAAATGGCAAATACAC
AATCCATCCAAATCGGGGCCTGAGCCTTAGCTAGCCATCATCAACGCTCATCTTTTCAGCGCCTTTCCCAGCCGCGCTCCGCTGCATCTGCACCTGCAGG
GCGTGTTTCTTTTCCTCGTGCCGAATTCGGCACGAGGTTTTTTTTTTTGGAAATCATCCGGTCTCCGATTTCATAAGAACAATAGATACATTAATGCACA
ATCTTCACTCAAACCTTAGGTCTGCACCACTCTAATGGCAAGACCAGGTACATCTTATTTCTTATCAGAAACGGCAAGCAGGACAGGACACCATCAACTC
TCAATTGCGACACCAGGCGCTGCAACCTCGATCATCCTCGGCTTCTTGCTGGTTCCTGTCAAGATGGTTGCTGGGAGATGCTCCTGTTCATAGGCCGAGA
GATGGACTCCAAGTGCTGCTCTCCCTGAGGGATCCAGGTTCCCCGACCACTGAGCATCCCACTCTACCGCCTTTGCCGTGCTGCATGCAACGCTTGGCCC
GCCTGGCACCGTCAGGATCGCCGAGTTCTGGGGGAAGAACCTCTCAAATATCATCCTGTAACAGTAGGCCTCTTTTGTAGTCGGGGTGTTGTGCGGGTAG
ATGAACTTTGCATTTGACATCATCTTATCGGTCACATTTGATTCTGCGTGAGCCTTTAGGCCATCAATCCAGCTATAGCCAACACCATCACTGAACTGCT
CTTTCTGCCTGTACAGAATGTGCTTTGGCAGGAATGGTTGCTCCTCGTCATCAAATGCTTTCCTCAGCACCCACTTCTCAATTCTTCCAAGATCAGGTCG
GATCATCTTCCACTCAGGATCTATGCTCATTGCCTCATTGATAAACTCCTTGTCCAGGAATGGCACACGTGCTTCGAGTCCCCATGCAGATGTTGCCTTG
TTGGCCCTCAAGCAATCGTACTGATGCAGAGCTTTGATCTTTTGACATGTCTCACGGTGGAGCTCCTCTTTGTTGGGTGCCTTGTGGAAGTAGAGGTACC
CTCCGAAAATCTCATCGGAACCCTCACCAGAGATGACCATCTTGACGCCAAGTGACTTGATCTTGTCGTGACATCAGGAACATTGGCGTGCTTGCCCTGA
TTGTCGTCACATCATATGTTTCGGTGTGATAAATCACATCCTCAAT
page-top