Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7691  (registered. 2012)
Contig Information
Length 999 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_VHS Shoot with heat shock treatment 3
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XV Leaves, plant was grown at constant 23Ž 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|42742277|gb|AAS45241.1|| indole-3-glycerol phosphate lyase [Hordeum lechleri]
Score 480
Evalue 1.00E-133
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7691
TTTTTTTTTTGATGAGTGAGCCGGGACCAAAATCATAGAATCGAGGGTTGTCCATAATCTCTGGCCGGGCACTAACAAATATATTCAAATAATTAGTGTC
ACAATTTTGCTTAAATTGGATAAAAATGTAAAAGGTCTGCTAAATGGGGTAAAATTTGCCACAGACATGAAACACGGGGTAAAATGGAATTCACTCGTTC
ATATATCATGGCAGTACATCCTTCAAGCCCCTGGCATAGACTTCCAACCTTTTCAACCCTTCTTCTGGAGAAGTCGCTTCACCCAACTGCTTCACCATTG
CACTCCCGATGATCACTCCATCCGCACCCCACTCTGCAATCTGCTTAACATGGTCAGGGGTCGAAATTCCAAAGCCAACAGCCACTGCCTTGTCAGTGAC
CTGCTTAATCTCCTTAAGAAGACTCTCAACGCGCGGGTTCACGGTTGGACGGGCACCTGTAACTCCGTCGACACTTACAAGGTAAATGAAGCCTCCTGAA
GCTTCAGTGATCTCCTTCATCCTCTCCGACGGCGTAGATGGTGTTGTAAGTAGCACCAGCTCTAGCTCGTTTTTGATGGCTTCATCCCTGAAAGCACTTG
TCTCGGCGTAAGGAAGATCGGGTACTATAAGACCTTTCACGCCGGCTTCCTTGACGGCGGCGGCGAAGCTCGCCATCCCTCGCTGTGCAATGGGGCTGAA
GTAAGAGAAGATCACCACGGGGCAGGAAAGCTGCGGTGTCACCTCCTTCAGCATCGCCATGATGGCGTCAGCCGTCGCGCCAGCGGCCAGCGAGCGCGCC
GCGGAGGCCTTGATGACGGCCCCGTCGGCGGAGGCATCCGAGAAGGGCATGCCGAGCTCGACGACGTCCGCGCCCAGGGCGTCGAGGAGCCTCAGCGCCG
CCGCCGTCGTCGCCAGGTCGGGGTCGCCGGCGGTGATGTACGGGATGAACGCCGTCTTGCCCTTCTCCATGACTTTTGACATGGCCTGCGACACGGACA
page-top