Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23467  (registered. 2003)
Contig Information
Length 1247 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 2
Homology (BLAST) Top Hit Os01g0896800 [Oryza sativa (japonica cultivar-group)] >gi|122222375|sp|Q0JGY1|RL51_ORYSJ RecName: Full=60S ribosomal protein L5-1 >gi|56785265|dbj|BAD82174.1| putative ribosomal protein L5 [Oryza sativa Japonica Group] >gi|113534614|dbj|BAF06997.1| Os01g0896800 [Oryza sativa (japonica cultivar-group)] >gi|169244415|gb|ACA50481.1| 60S ribosomal protein L5 [Oryza sativa Japonica Group] >gi|215737756|dbj|BAG96886.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1242
Evalue 1.92169e-134
Total Hit Count 448
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23467
CACCCCCAGTCCAGCAGGGGTCTCTGCCCCGACGCCGTTCTAAACCCTCCCCTCTCCCACTTCTCCACTCCTCTCCCTCCCCAAGAAAAACCGCCGCCGC
CGCCGCCGCAGCAGCAGCAGGCGAGCGAGATGGTGTTTGTGAAGAACCAGAAGACCAGGGCGTACTCCAAGCGGTTCCAAGTGAAGTTCAAGAGAAGGAG
ACAGGGGAAGACCGATTACAGGGCCAGGCTCAGGCTCACTAACCAAGACAAGAACAAGTACAACACGCCCAAGTACCGGTTTGTTGTGCGATTTACCAAC
AAAGATGTCACTGCCCAAATTGTGTACGCCACCATCGCTGGTGATATCGTGATGGCTGCTGCCTATTCCCATGAGCTTCCTCGGTATGGTCTTGAAGTTG
GCCTTACCAACTATGCCGCAGCGTACTGCACTGGTCTGCTTTTGGCCCGTCGTGTGCTCAAGTGCCGTGATTTGGATCAGGAATATGAGGGCAATGTTGA
GGCCACTGGGGAGGACTTCTCTGTTGAGCCGGCAGATGAGAGGAGGCCTTTCCGTGCGCTCTTGGATGTCGGCCTTATTAGGACTACTACTGGAAACCGT
GTGTTTGGTGCCCTTAAGGGAGCTTTGGATGGTGGTCTTGATATTCCGCACAGTGACAAGAGATTTGCTGGCTTCAAGAAGGATGAGAAGCAGCTGGACG
CTGAGATTCACCGCAAATACATCTATGGAGGCCATGTTGCTGACTACATGAAGTCACTGGCTGATGAGGAACCTGAGAAGTACCAATCTCACTTCAGTGA
GTACATCAAGAAGGGGATTGAGGCTGATAACATGGAAGCACTGTACAAGAAGGTTCATGCTGCCATTCGTGCTGATCCTACCATGGCAAAGTCAACCAAG
GAACCTCCAAAGACGCACAAGAGGTACAATCCCAAGAAGCTGACCTATGAGCAGAGGAAGGCCAGTCTCGTGGAGCGGCTCAACGCCCTCAACTCATCTG
CTGGTGCTGATGTCGATGAGGACGACGACGAATGAGTGTAATCGACCGTAGGCCCCTTTAGTGCTGTCTTCATGCTTCCAAATGTACTTGCTCCATGCAT
TAAAGAGTAGTATCGCGAGAGAGACATATATGCACATTGTACCTGCCCTTGGTTTTGAGTACCATGCTGGAGTTCTGGATTATCTTACATTATACAAGGT
GCTGGCATTTTGATGTTGCTTCAGACTTTGTTGATCTGGATCTCTGT
page-top