Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23462  (registered. 2003)
Contig Information
Length 1898 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 1
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 1
Wh_VHS Shoot with heat shock treatment 2
Homology (BLAST) Top Hit hypothetical protein OsJ_017237 [Oryza sativa (japonica cultivar-group)]
Score 2398
Evalue 0
Total Hit Count 352
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23462
GCCAAACTCTACCGGAACGGGCGCGCTCCCGGCATTTTCTCCATAGCCCTCGTCGCGGACGAAGGCAGTAGATCCGGCGGACGGCGGCCCGGCGCATCTC
CTCGCCTGCGAAGGTGCATAATTTGCTGGCTTGTGTTAGTTCGGGGGACCAACAAAGTTACTGAAAATGGTGGTTCTTGCTGCTTCCATCATCTCAAAAT
CTGGAAAAGCACTTGTTTCAAGACAGTATGTTGACATGTCTCGAATTAGGATCGAAGGATTACTTGCAGCATTCCCAAAACTTGTTGGAACTGGGAAGCA
GCACACTTATCTTGAGACTGAAAGTGTCCGTTATGTTTATCAACCTATTGAAGGCCTATATCTGCTGCTTATTACAAACAAGCAGAGTAACATTCTTGAA
GATCTGGACACACTGAGGCTACTATCCAAGCTTGTGCCTGAGTACTCTTCTCTGGATGAGGATAGTATCTGTAAAACAGCATTTGAGCTTATATTTGCAT
TTGATGAGGCAATCTCTCTCGGAAACAAGGAAAATGTGACGGTGCAACAAGTCAAGCAATACTGTGAGATGGAAAGCCATGAAGAGAAGGCGCATAAGCT
GATGATGCAGAGCAAAATCAATGAAACTAAAGATGTCATGAAGAAGAGAGCTAGTGAGCTTGACAAAATCAGGATGGAGAAAGGCAAACTTGACAAAGGA
GGATACTCATCAATATCTGGTCCCCGTGTTATTGAAAAAACTTTCAGTGACATGAACATTAGTGGTACTGGCTTTGGAAGTGGTTCTGGATTAAGTGGAA
TAGGCGCTGATATGGACTCGTTTGCGAGTAAACCCAAAGGTCGTCCGTCAGCTGCTGCTACTGCTCCTGGCAAAGGTTTTGGTATGAAATTAGGCAAATC
ACAGAAGACAAATCAGTTCCTACAATCTTTGAAAGCTGAAGGAGAAGTCATTTTGGAGGATGCACAACCAAGTTCAGTTTCTTCAAGGGCCTCGCCTCTT
ATACCAAGCGATCCCATCACAGTGACTATTGAAGAGAAACTTAATGTAATAGTTAAAAGAGATGGAGGTGTTAATAACTTTGATGTGCAAGGAACCCTTG
CTCTTCAGGTCCTTAATGATGCAGATGGATTTATCCAGTTACAGATCGAAAACAAAGATGTACCTGGACTCAGCTTCAAAACACACCCCAATATCCACAA
GGAGTTGTTTAACAGCCAGCAAATTGTTGGAGCAAAAGATCCAAACAGGCCTTTCCCAAGTGGTCAAAATGAAACACCACTTGTGAAATGGAGAATCCAG
GGGATGAATGAATCGAATTTACCTCTGTCAGTTAACTGCTGGCCCTCGGTATCTGGAAATGAAACCTATGTCAACATTGAATATGAGGCTTCAGAGATGT
TTGACCTGAACAATGTTGTCATATCTATTCCTCTACCTGCACTTCGGGAGGCTCCAACTGTTAAACAGATTGATGGAGAGTGGAAGTATGACCCAAGAAA
CTCTGTATTGGAATGGTCCATCATCCTTATTGATCAGTCAAACCGCAGTGGGTCGATGGAATTTATTGTTCCCCCGGCTGATCCGTCAACATTTTTCCCC
ATCTCTATTGGATTTGCTGCTTCCAATACTTTCAGTGATTTGAAGGTCACTGGAATTCATCCTCTGAAGGAAGGCAACCCTCCAAAGTATTCACAGAGGG
TCCGTTTGGTTGCTGCGAACTATCAAATAGTCTAAAGCCATAATTAAAGCAGTTACTGCTGTTTCTTGTTAGTGGCACAAGGAGTATAATTTTGCATCAA
ATTTGTTTAAATATGTGTGATTTGGCCTGTCCCATACGTAGCGTGTCGCACCATTGAGAAATAAAAGCATGAATTCTCCTGTACCCTGTTTGTAGTAT
page-top