Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23455  (registered. 2003)
Contig Information
Length 750 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_PCDAM Anther at meiosis 15
Homology (BLAST) Top Hit GF24895 [Drosophila ananassae] >gi|190623129|gb|EDV38653.1| GF24895 [Drosophila ananassae]
Score 78
Evalue 7.85883
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23455
TTTTTTTTTTGACAGGGAGAAAATAACCACCTCGCTGACTAAGGAAATGCAAGGACAACCACAAACGTTCCGCAGCCGAAGGCGTCGAGAACGAAGCAGA
AGGGAAATAATGGCGGTGCTCCGACAGCTGCGACAGGCCGCAGCGCACGGACGGGAGCACTATACATGACTAACAACACCACAGATATCTTGGGCGCGCT
AAGGCCGATAGAGAAACTAAGGCAGAGGTGGGGAAATGGCGATGCACGTCACATATACCCGAAGTCGATCTTGAGGGCGTTGGGACCTTCCTGGCCGAGC
TCGCGGTTGAGCTCCTCCTTGGCCTGGGCGAACGCGTCCTCCTTGGTGCCGTCGTCGGCGCCGCTCTCCAGCACCGTGCTGACGGCTCTGAAGATGGGCT
TCCACCGCTGGGCCTCGAGGTTCACCACCCCCAGCGCCCACTTGAGCTTCTCGGCGTCGCTGGTCTCTGGCCTGTGGCGGGAGATGACGGTTATGGCCTG
CGCCATGGTTTCCTGCCGCAGCTGCAGGTCCTCGTCCCCAGCGGCGACTGGGCTGTTGCTGGCGGGGAGGAGGAATTTGACCTCGATGGTGCGAGCATCA
TGCCTGAAAATCACACTGGCCTTCGCCTTGTACATCGCGCTGGCAGCGGCAGCGCTGTTGCAGCTGGCGGCGAAGGCAAGCAGGAGGAAGAGGAGACGGA
AGGCGGCCATGGCGAACGGAAGATTGGTACGTCTCTTCTCCTGAACAACG
page-top