Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23448  (registered. 2003)
Contig Information
Length 2076 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 6
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 3
Wh_VSCB Liquid cultured tissue 4
Homology (BLAST) Top Hit Os09g0397300 [Oryza sativa (japonica cultivar-group)] >gi|50252610|dbj|BAD28781.1| putative trehalose-6-phosphate synthase/phosphatase [Oryza sativa Japonica Group] >gi|113631337|dbj|BAF25018.1| Os09g0397300 [Oryza sativa (japonica cultivar-group)]
Score 2671
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23448
CGGAGATCTACAAGACCCTGCCGGTTCGAGAGGAGGTGCTCCGGGCGCTGCTGAATGCCGACTTGATTGGGTTCCACACATTTGATTATGCCAGGCATTT
CCTCTCATGCTGCAGCAGGATGCTGGGAATGAAATACGAGTCGCAGAGGGGGTACATTGGACTGGAGTACTATGGACGGACTGTCACTGTCAAGATACTG
CCGGTGGGGATACATTTGGGGCAGCTGCAGGAGGTGCTCAACCTCCCGGAGACCGGGCTCAAGGTCGCCGAGCTTATCAAGGAGTTCCGTGATCGGGGCC
GCATCATGATGCTTGGTGTAGATGATATGGACATATTTAAGGGCATCAGTCTGAAGCTTTTGGCATTTGAGGAGCTCTTGACGCAGCATCCAGAGTATCG
AGGAAAGGTGGTGCTGGTACAGATTGCCAATCCGGCGAGGGGGAAGGGGAAGGATGTGAAGGAGGTACAGGATGAGAGCTATGCCATGGTGAAGCGCATC
AATGAGGCATTTGGGCAGCCAGATTACCAGCCAGTCATATTGATCGACAGGCCACTGCACTTCTATGAGAGGATGGCATACTATGTTGTTGCTGAGTGCT
GCTTGGTGACCGCAGTGAGGGATGGCATGAATCTTATACCATATGAGTACATCATTGCTAGGCAAGGGAATGAGAAGATTGACAGGATCCTGGGTCTCAG
CCCTTTCACAAGGAAGAAGAGCATGCTTGTCGTGTCGGAATTCATTGGCTGCTCACCCTCCCTGAGTGGCGCGATTCGGGTGAACCCTTGGAACATTGAG
TCGGTGGCCGAGGCAATGGACAAGGCCTTGCACACAGGTGAAGGTGAGCAGGTGCTGAGGCACGAGAAGCATCACAAATTTGTGAGCACACATGATGTCG
GATACTGGGCAAACAGCTTCCTGCAGGATCTGGCGAGGACTTGCCAAGACCATAACAAGAGGCGCTGCTGGGGCATAGGATTTGGGCTAAGGTTCAGGGT
TGTGGCCCTTGATACGAGCTTCAAGAAGCTCGCGGCTGAGCATCTTGTCTCAGCCTACCGGAAGGCAACCACGCGCGCCATTCTCTTGGACTATGATGGT
ACGCTGATGCCTCAGTCATTGTTTGGTAAGATGCCGAGCCCCGAAACAACAGACATGTTGAACAGCCTTTGTCGCGATGAGAAGAACATGGTCTTAATCG
CAAGCACAAAGACCCGGGAGACCTTAAGTGAATGGTTCTCAGCATGTGAGGACCTAGGCCTTGCTGCTGAGCATGGCTACTTCATCAGGCTGGAAAGAGA
TGCAGAATGGGAGACATGCGGCCTGTCAACAGACTTCAGCTGGAAGCAAATCGCGGAGCCGGTGATGAAGACCTACACCGAGACAACGGACGGGTCGATC
ATCGAGGACAAGGAGACAGCAATCGTGTGGTGCTACGAGGACGCGGACCATGATTTTGGATCTTGCCAGGCCAAGGAGCTCCATGATCACCTGGAGAGTG
TCCTCTCCAACGAGCCGGTATCAGTCAAAGCTGACCTGCACTATGTTGAGGTGAAGCCACAGGGTGTGAGCAAGGGCCTGGTGGCGAAGCGGATGCTGTC
GACAATGCAGGAGCTGGGGCTCCAGCCCGACTTCATCCTCTGCGTCGGGGACGACCGCTCCGACGAGGACATGTTCGAGGTGATCACCACCGCGGTGGAC
GGCCCCTACCTGAGCCCTTCCGCGACGGTCTTCGCCTGCACCATCGGCCAAAAGCCCAGCAAGGCCAAGTACTACCTGGATGAGCCCGCCGACATCAAGC
GCATGATCCGGGCCCTCGCGAGCGTCTCTGACCAGGAGCTGGCGATGGAGGAGGGCGAAGACCCTCCTTACCCTTTCCTCGCCGGCGACGGCACCAGCAG
CGACGACACCTGGCTGGACTGAGGGGGGAAGCCGGCAGAGACGACCAGCAGCAGCGCAGCCTCCGGCCTGAATAAGACAGCATAATGGACGTAAACGGCA
CCATAGTTGTGTTTCTGCTTGGTTGTTGTTCTGCTTGTTTCGCCCGTTGTGTATATAGACTCCGTGAACCTTGTAA
page-top