Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23419  (registered. 2003)
Contig Information
Length 1028 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 6
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 4
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195605228|gb|ACG24444.1| histone H2B.2 [Zea mays] >gi|195605966|gb|ACG24813.1| histone H2B.2 [Zea mays] >gi|195608636|gb|ACG26148.1| histone H2B.2 [Zea mays] >gi|195623720|gb|ACG33690.1| histone H2B.2 [Zea mays] >gi|195644270|gb|ACG41603.1| histone H2B.2 [Zea mays]
Score 511
Evalue 8.38604e-50
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23419
TTTTTTTTTTGAAAAGGCACATACAAACTCCTCCATTAGTACTTGAAATCAAAGCCGTCCATTACAACCTGGCACGATTTACAAAGCAGACGAGCTACCT
ACCTATAACGACACACATGGACACAAGCGACGGCAACACAAAAGCTAGTAGAAGAGAACACGGCGACGGAACCCTAGAGATACACCGCGACGGAACCCTA
GTTGCTGGTGAACTTGGTGACGGCCTTGGTGCCCTCGGAGACGGCGTGCTTGGCGAGCTCGCCGGGGAGGACGAGGCGGACGGAGGTCTGGATCTCCCTG
GACGTGATGGTGGGCTTCTTGTTGTACCTGGCCAGCTTGGCCGCCTCGCCGGCGAGCTTCTCGAAGATGTCGTTGATGAAGGAGTTCATGATGGACATGG
CCTTGGAGGAGATGCCGATGTCCGGGTGCACCTGCTTGAGCACCTTGAAGATGTAGATTTTGTAGGTCTCCACGCTCTTCTTGTTCTTCTTCCGGCCCTT
CTTGTCGCCGCCCTCCTTGGCGGACTTGGACGCCGGCAGACGCTTCTCCGCCTTGGGCTTCTTGCCGGCGAGGGTCTTCTCGGCCTTCTCCGCGACCTCG
GCGGCCGGCTTCTTCTCCGCGGGCTTCTTCTCGGCCTTGGGCGCCATCGATCGGGATTGAGCTTGAGGTGTCGGGCTGCTGTGGAGGGAAATGGGCGAGT
TGTTGCGAGCCTCGTGCCGAATTCGGCACGAGGCAAGCTGCTCGGATAATTTCATTACCTTCGCGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACAC
AGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATT
CGAGTTCGAGCCGGTAGATACTATTGATAAGTAGATAAAACTAAAGATAAAGAAGAGAAGGTATAAATAAAAAAGAAACGAAATAAAAAGAGAAAAAAAT
AAGTTATGAAATGCAGTAATTCTTCTTT
page-top