Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23416  (registered. 2003)
Contig Information
Length 1259 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 6
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit histone deacetylase HDAC2 [Triticum aestivum]
Score 1039
Evalue 6.74693e-111
Total Hit Count 188
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23416
GCCGGCTTAACCCTAGACGACTAGACCTAGGGCTCCTCCGACCACCGCCGCCGGTTGCCATGGAGTTCTGGGGCCTTGAGGTTAAGCCTAACCAGTCCGT
CAAGGTTTCACCTGATGACGAGCACTTCCTCCATCTCTCCCAGGGTGCCCTTGGTGAAGTGAAGAAGGATGACAAGGCAACCATGTTCGTCAAGATTGGC
GACCAGAAGCTAGCCATCGGGACCCTCTCTACTGACAAGTTCCCTCAGATCCAGTTTGACCTCGTCTTCGAGAAGGAGTTTGAGCTCTCACACAATTCCA
AGACGTCCAGCGTCTTCTTCTCTGGCTACAAGGTCTTCCAGCCTGCCGAGGGAGATGAGATGGATTTTGATTCCGAGGACGAGTCTGAGGAGGAGGAGGA
AGAGAAGATCATCCCAGCACTCACCAAGGAAAACGGCAAACCTGAAGCCAAGGAGCAGAAGAAGCAGGTTAAGATTGACACTGCTGCACATTCAAAGTCA
AAGGCTGCTGCCAAGGATGTGGGAAAATCTAAGAAGGATGATGACAGCGATGACGATGATGACAGTGATGAGGATGACAGCGAAGATGACTCTGGTGATG
ATGGAGCATTGATTCCCATGGAGGATGATTCTGATGATAGTGAGGATGGTGATGATTCCTCTGATGATAGTGAGGATAGCTCTGATGAGGAGGAAGAAGA
AACACCCAAGAAGCCAGAGACTGGGAAGAAGAGGGCGGCTGGAAGCGTGTTGAAGACCCCTGTTACTGACAAGAAGGCCAAGATTGCAACACCGTCAGGC
CAGAAGACAGGTGACAAGAAGGGAGCTGTCCATGTGGCGACTCCTCACCCGGCCAAGAAGGCAGGCAAGACCCCGGCTACCAGCGAGAAGTCGCCCAAGT
CTGGAGGGTCGGTCGCGTGCAAGTCGTGCAGCAAGACATTCAACAGCGAGGGCGCTCTAGCTTCGCACTCCAAGGCCAAGCACGAGGCCAAGTGAAGAGG
AGAGGAAGATGTTGGCTGGCTGGCTGGCTCCAGTTACTATTATTTTGATCTGTCTGTCCTATGAGATTATTATCGTTATGCTGCTGTGTTAGGCTATCTA
TCCTTGTGTTGTCGTGTTCCCTACCTACCTAGCTAGCCTGATCCTGAGGGAAGGGAAGGGAGAAACCGTTGAGCTGTTAGTGATGATGCGTTGGTTGTTG
AATCAAACAAAAAAGCCGCTGTGATTCGGAACTTGGAACTTGGAATTGGATGGTGGAAT
page-top