Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23413  (registered. 2003)
Contig Information
Length 1977 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 4
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 3
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit hypothetical protein OsI_11566 [Oryza sativa Indica Group]
Score 1594
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23413
CTCTCTTCCCTCCCCCCTCGCCGCCGCCGCCGCCACCGCTCGTCTTCCCTCCTATACACAGGTGCGGAGGAGGAGATGTTGGTGCTCTTCGAGACGCCCG
CGGGGTTCGCCCTCTTCAAGGTGCTGGACGAGGGGAAGCTCAGCAGCGTCGAGGATCTGTGGAAGGACTTTGCCTCGTCGGACAAAGCAAGGAAGGTGGT
TGAGCTGAAGGCTTTCAACAAGTTTGAAAATACTTCTGATGCTCTTTCAGCCGCAACTTTGCTGATTGATAGCAAGCCCAGCAAGGGTCTGCGCAAGTTC
CTGCAGAAGCACTGTGATGGTGAAACATTGGCTGTTGCTGATTCCAAACTTGGGAATGCCATCAAAGAAAAGCTGCAAATTGATTGCCTTCACAACTCTG
CTGTTATGGAACTGATGAGAGGGCTGAGGAACCAGCTCACTGAACTTATGTCTGGACTAGCTGAGCATGATCTAGGTCCAATGAGCCTAGGATTGTCCCA
CAGCTTGTCTAGGTATAAACTCAAGTTCAGCCCTGAAAAGGTTGATACTATGATCATTCAGGCCATTGGCTTGTTGGATGATCTTGACAAGGAGCTTAAC
ACTTACGCTATGAGGGTCCGTGAATGGTACGGTTGGCACTTTCCGGAGCTCACAAAAATTGTTGCAGATAACATCCATTATGCGAAAGCTGTGAAGATGA
TGGGCAATCGTGTTAATGCAGTTAACCTTGACTTCTCTGAGATACTTCCAGAAGAAGTGGAAGCAGAGCTGAAGGAGGCAGCTGTAATTTCCATGGGAAC
AGAAGTCAATGATCTTGACCTCTCAAACATCAGGGAACTGTGTGATCAAGTCCTGGCTCTTTCTGAGTACAGAGCCCAGCTCTATGACTATCTAAAAAGT
AGGATGAATACCATTGCTCCCAACTTGACTGCACTTGTTGGTGAACTTGTTGGTGCTCGCCTTATTTCCCATGGTGGTAGTTTGATGAATCTGGCGAAGC
AGCCTGGCAGCACGATTCAGATTCTGGGGGCAGAGAAGGCCTTATTCAGAGCTCTGAAGACAAAGCATGCCACACCAAAGTATGGTCTCATCTATCATGC
ATCATTAATTGGACAGGCGGCTCCGAAGCACAAGGGAAAGATCTCTCGCTCGCTTTGCTGCTAAGAGTGCACTTGCCATAAGATATGATGCCCTTGCTGA
CGGTGACGATAACTCCATGGGTCTTGAAAGCAGGATCAAGCTTGAAACACGGCTTCGAGTTCTTGAGGGTAAGGAACTTGGGAGGTCTGCTGGTTCCACG
AAAGGAAAGCCCAAGATAGAAGCGTATGAAAAGGACCGGAAGGGTGGTGGTGCTCTGATCACTCCCGCTAAAACTTACAACTCAGCAGCAGATCTAGTGC
TTGGACAAACCACTGAAGAAACGCCAAAGAAGTCAGAAGTTGCTTCAAAGAAGAGGAAGCACCAAGAGGAAGAACCTACTGCGGAGGCAGCTGAACAGGA
CGGCGAGCAGGAGAAAGAGAAGTCCAAGAAGAAGAAGAAGAAATCCAAGGACATCGAGGAGACTCCAGCAGCCGTCACCGACGCTAGCGAGAAGAAGAAG
AAAAAGAAGAGCAAGGAGGCCGAGGACACCCCTGCAGCCAACACCGACGGTGAGAAGAAGAAAAAGAAGAAGAAATCAGACGCTGAGGACGCCCCCATGG
AGGTTGACGTGTCTGCCAAGAAGGAGAAGAAGAAAAAGAAGAAGCACGCTGACGAGTGAGCGGCATGGAGATACGCCGGAAATTTGTGGTGTAATGCTGT
ACTATCATCGTTGTCTGAAAGTTTTGGGACTTGCCGTTCATGTAGAATGGAATGCCACATTAGGATTAGCAGCGACGAACCCTACAATTCGAAACTTGCA
AGTGGTGAGCAGTCACTTTAAGAGGCCCAATGCTGTGCTCTCATCTATAACATCTGCCAGTATGTTCAAAAAAAAAA
page-top