Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23398  (registered. 2003)
Contig Information
Length 578 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 6
Homology (BLAST) Top Hit histone H4 [Zea mays]
Score 410
Evalue 1.42101e-38
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23398
TGAACAATTTCACATTAACAGAGATGCAGCAGGGACAAAATCAGAGGCACGGTATCTCACTTAGACAAGTTTGAATTCTAACAAACTGCGAATAGGTTTG
CTCCACGATTCAGTTCGAAATACAGAGGAAATAGCGAACTACAGAGGAAGTAGAGAACTACACAAGTCGCGGTATCATCAAACTTTTGGGATCTGCAAGG
GGGCAAGGAAGAGCCTAGCCGCCGAAGCCGTAGAGGGTGCGACCCTGGCGCTTGAGGGCGTAGACGACGTCCATGGCGGTGACAGTCTTGCGGCGGGCGT
GCTCGGTGTAGGTGACGGCGTCGCGGATGACGTTCTCGAGGAAGATCTTGAGCACGCCGCGGGTCTCCTCGTAGATGAGGCCGGAGATGCGCTTCACGCC
GCCCCTCCTCGCCAGGCGCCGGATGGCGGGCTTGGTGATGCCCTGGATGTTGTCGCGCAGCACCTTCCTGTGGCGCTTGGCGCCGCCCTTGCCGAGCCCC
TTGCCTCCCTTGCCGCGCCCCGACATGGCTGAAGATCTCTTCTTGGTTCGAGCCGCGAGAGGATGGGGGTCGAGGAGC
page-top