Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23347  (registered. 2003)
Contig Information
Length 636 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 4
Wh_VHS Shoot with heat shock treatment 1
Wh_VWD Shoot grown with dessication 1
Homology (BLAST) Top Hit ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Beckmannia syzigachne]
Score 919
Evalue 1.70932e-97
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23347
CAGTCCTGTAATGCCTACTTGTCACAATCTACACGTGGCATACGGTCACTACTGCGAAATCATGGTATGCATTTCCGTGTATTAGCTAAAGCATTGCGTA
TGTCTGGGGGAGATCATATCCACTCCGGTACAGTAGTAGGTAAGTTAGAAGGGGAACGCGAAATGACTTTAGGTTTTGTTGATTTATTGCGCGATGATTT
TATTGAAAAAGATCGTGCTCGCGGTATCTTTTTCACTCAGGACTGGGTATCCATGCCAGGTGTTATACCGGTAGCTTCAGGTGGTATTCATGTTTGGCAT
ATGCCAGCTCTGACCGAAATCTTTGGGGACGATTCTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTA
ATCGAGTGGCTTTAGAAGCCTGTGTACAAGCTCGTAACGAAGGGCGCGATCTTGCTCGCGAAGGTAATGAAATTATCCGAGCAGCTTGCAAATGGAGTCC
TGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTTCGAGCCGGTAGATACTATTGATAAGTAGATAAAACTAAAGATAAAGAAGAGA
AGGTATAAATAAAAAAGAAACGAAATAAAAAAAAAA
page-top