Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23340  (registered. 2003)
Contig Information
Length 1055 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 3
Wh_SHC Shoot grown with cold treatment 4
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit pyruvate kinase-like [Deschampsia antarctica]
Score 1280
Evalue 5.90857e-139
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23340
TTTTTTTTTTGGTCACAAAGTTTTGATATCATTATTCCATCAGATCATTTACTCGCTACACTGCAGTAAAATCTGAGGACATATCCATAATAACTAGCGT
AGGTTTCAGAATGATAACCGCGGATCCTATGATGACACCATAGGAAAAACTGCTCGTTTTGCAAAACTATAGATAGAATTATACATAGCCACCAAGCAAC
GTTTTGGCCTAGTCAAAAATCTGGCAAGCCCTGAGCAAAGGCTAATTTTGCCTAGTCGTCTAGCTCAATGATCTTCACGACAGAGGAATCTCCCACTTTC
TGGCACACGACGACACGGTCATGCGACTTGATCACACCAGATGCTTTGCCGTGGTCAAGAGCAACCTTCAACACTGATTCATTTGTAGTGCTAGTAGATT
CAGCCGGATGACGTGGATCAGCAAGCATGGGAAAGAGGCCTCTAACTATGAGTGATTGTCTTGCCTCAAATGCACCTGTGAAGCTCCACTTCAATTGATT
TGTTTTCAGACGAGGAATGACAACGGACAGGACAGGCATGGTGGGCCTGTACTTGGCAATTAGCCTTGCAGCCCGTCCAGATGAAGTGAAGCAAATGATG
ACCGAAGCCTTAACTTTAATAGCAGCCCGCACTGCAGAGGAAGCAATAGACTCCAAGTGGGTCATGGGTTCTCCCACATATTTCACGGTTCGCTTGAAAT
ACAAATCTTGGTTGAAGACCTTCTCAGCCTCAGCACAAATTCTGCCCACTGTTGAAATAGTCTCGACTGGATACAACCCACGGAGAGTCTCAGCACCAAG
GAGAATGGCATCACTACCGTCCAGCACCGCATTTGCCACATCAGTTGCCTCCGCACGAGTAGGCCTTAGGTTGTCCGTCATACTGTCCACAACACGAGTA
ACAACAGCAGGCTTTCCAGCCATGTTGCACTTGTGCAGAGCAGACTTCTGAAATAAGAACACCTTTTCAGGTGGAAGATCAATTCCAAGGTTCCCTCTTG
ACAGAATGATACCATCCGCTTCCTCCAAGGATCTCATCAAAATGGTTCAAGGCCC
page-top