Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23330  (registered. 2003)
Contig Information
Length 1286 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_SHC Shoot grown with cold treatment 4
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VHS Shoot with heat shock treatment 2
Homology (BLAST) Top Hit hypothetical protein 57h21.24 [Brachypodium sylvaticum]
Score 760
Evalue 3.97588e-88
Total Hit Count 98
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23330
AGACAAGACAAGCAAAGAAGCAAATGTTTGTTCGAGCTCAACACATAAAGCATATATCAGATACAGAACATGGCTATCCAAAGTGTAACAATTTATCTTG
AAATCACCACTAAATTGCTTAGCCGGCCAACAGATTTTGCATTGTACACCCTAGTCGGAGACACTTTTCCCTAGGGAAGGCAGAGATCGCAGGGGAGACG
AGACCCATTGACTGCTGCGCAACGCCCGCAGAGTATAGCAATGTTAGTACAACAAGAACAGAATCCCCATGGTTTTCGGCTTCTGGCAGTCACCTCCACC
TGGCGCCTCCCAATCTGATCACCTCTTCAGTTCCGGAGTCCCTGCGAGATCTGTCATCACCGGCATCGTCCTTTGCGTTCGTCGCGTCGCCGTACAGATC
CTTCAGCTTCGCCAAGTTGGATGACTCTGGCGCTTTACCAAACGGGCTGGAGCGATGGCTGTCACCATTGGTTCTGCCACGGCTCGGACTCCTGCTCCTG
CTCCTGCTCCTGCTTCTGCGGCCACTCGAACGTCCATTTCGATCGGAGTCCCTATCCCTCCTTTCATGGCTCCGCCTCTCGACATCCCTATCAGAATAGC
TCGAGCGGCGGTAGTCACGGTCTCTGTTATCACGGCTGTGCCGACCATGCTCCCTATCCTTGTACCTACCACGATCGCGATCTGAACGGTCCCTGTCAAT
GTCACGGCTGCGCTCACGACTCTGACTTCGGTGCTTCCTGGGTGGAGATTTGGCATGACCGCCATCATGACTCCTTTCCCTTTCTCGTACAGAAGGCAAT
GTCTTTCGGACTGGGGGATGAATCCCTTGTGGATGCACGGTGTGGAGCACGCTGACCAAAAGAGACGGACAGAGAAGCCTTCACTGAAGGAGGCCGCCGG
GCAGTATCATCTGAACCAAGGCGGCTAGAATCCCCGGTTATCCCTGACTGCTTTGTTGGGAGCTTCATTTTCTCAAGATGGGCAGTAACCTGTCGCAGAA
TTAGGAGAGGCACTCGTGGAAGAAGACTGTCGAAGTAGTACTGACCAAGGATGACATCACGCACATAAACGCCCATAGTAGTCATTTTACCATTGGATCC
AGGGGAAAACTCCTCATCATCTTGAATGTAGGGCTCATACCAGGTCCATAAGGTCTTTGGGTCCGCGGCATAGCGCAGGTACAGAAACCCAATCTGTTGC
AAAAATAAAGCTCTGATGTAGGGGGAGTCCGGGTGCTTGAGCAGGCCGTGCATCTGGTTGACGGTGAGCTTCATGGTGAAGAGCTG
page-top