Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23327  (registered. 2003)
Contig Information
Length 1620 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_PCDAM Anther at meiosis 5
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 1
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit hypothetical protein OsI_09293 [Oryza sativa Indica Group]
Score 2082
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23327
GTCGTCGGCTTCGAGGTCGTGCCCTGCAGCATCAAGCACAACCCCGAGGACGCCAGGGCCCTCAAGATGTACGGAAAATTCCCCAGCAAGATCAAGTGCG
ACCCCTCCACCGTCTCCATGAGCATCAAGGAGAACGAGCCCATCGTCTACACCTACGAGGTCTCCTTCGTCGAGAGCGACATCAAGTGGCCCTCCAGGTG
GGACGCCTACCTCAAGATGGAGGGCGCCAAGGTGCACTGGTTCTCCATCCTCAACTCGCTCATGGTCATCGCCTTCCTCGCCGGCATCGTCTTCGTCATA
CTGCTCAGGACCGTCAGGCGCGATCTCACGAGGTACGAGGAGCTCGACAGTGAGGCGCAGGCCCAGATGAACGAGGAGCTGTCCGGGTGGAAGCTCGTCG
TCAGCGATGTCTTCCGTGCGCCCAGCAACCCAATGCTGCTCTGCATGATGGTTGGGGATGGGGTTCAGATCCTGGGAATGGCCGTGGTCACCATCCTGTT
TGCCGCGCTTGGGTTCATGTCGCCGGCCTCCCGTGGTACCCTGATCACAGGCATGCTCTTCTTCTACCTGGTCCTCGGGATCCTGGCAGGATACGCCAGT
GTCCGCGTCTGGAAGACAATCAGGTGTGGAGATCACTCGGGCTGGGTGGGCGTTTCGTGGAGGACAGCCTGCTTCTTCCCTGGCATCGCCTTCCTGATCC
TCACCACACTCAACTTCCTGCTGTGGGGAAGCCAGAGCACCGGCGCCATCCCCTTCTCGCTGTTTGTTGTGCTGATCCTGCTCTGGTTCTGCATCTCTGT
GCCGCTTACACTCGTCGGCGGGTTCCTTGGTGCCAAGGCGCCGCACATCGAGTACCCGGTCCGCACAAACCAGATCCCGCGCGAGATCCCCGCCCAGAAG
TACCCGTCCTGGCTGCTGGTCCTCGGCGCCGGCACGCTGCCCTTCGGCACCCTGTTCATCGAGCTCTTCTTCATCATGTCAAGCATCTGGATGGGGCGCG
TGTACTACGTCTTCGGGTTCCTCTTCATCGTGATGCTGCTCCTGGTCATCGTCTGCGCCGAGGTCTCCCTGGTCCTGACCTACATGCACCTCTGCGTGGA
GGACTGGAAGTGGTGGTGGAAGTCATTCTTCTCGTCCGGGTCCGTGGCCATCTACATCTTCCTCTACTCGATCAACTACCTGGTGTTCGACCTCAAGAGC
CTGAGCGGGCCGGTGTCGGCGACCCTCTACCTCGGCTACTCACTCTTCATGGTCATCGCCATCATGCTGGCCACCGGCACGGTCGGGTTCATCTCCTCGT
TCTGCTTCGTGCACTATCTCTTCTCGTCTGTGAAGGCCGATTAAGTTTCTCCTTGCGTGGAATGATCATTGAATTGAGAGGTGAGTAAGCATAGTGGGGA
GTGGGCATTGAAAAAGTTTGTAGTCATCACAGTCGGTAGTTCATCCCAACTTTTGGTATACATGTCCTGAATAACTATTTGTATGGTCTAGGGAGGATTC
GCCAGTGGGCTTTATGATGAGGTGCAGGCAGCTTGCACGATGTAATAGAATGAATTGGTTTATTCACATTTACCGCCATTTTAGCTGATCATTCTGCCAT
TTAGTACTCCAAAAAAAAAA
page-top