Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23312  (registered. 2003)
Contig Information
Length 2765 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Homology (BLAST) Top Hit hypothetical protein OsI_13865 [Oryza sativa Indica Group]
Score 3142
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23312
ATGGAACGGATAATGCCAGAGCTGCGAAGTGGTGTTCGGAGAGCTCGTCTGAGGTCCAGCAGGCTTGAAGACATCCAGGCTGCAGATCAGGTAGCCGCTC
CCGTGTTGCCAGCTCCCAGGGGGAGGGGTGGGAGGCGTGGTGGTGGTGCAGCTGGCAGAGGCAACAAGAAAGCAGCTGCCACGGGAAGAGGAAGGCCAGC
TCCAAAGGCTAGAGGAAAGAGGGTCGAGGCTATTGATCTGACTGACCAGCCTTTCGAGGACATCCCTGAAGCTATCGTTGGAGAGGCAGTTGCAGCCACC
GCCCAGCAGGACCTTGGTTTGAACAAGGTAGCTGACAGGGCCGCCAACTTCAAAATGGAAGGTGCAAGTGGTGATAGACTTGCAGCGGCGGAAGATGAAG
CCACGACGACGCCAGTGCCTGAGAGGGTTCAAGTTGGTGGTTCTCCAGAATATATAACTGATAGGAAGTTGGGTAAAGGTGGATTTGGCCAGGTCTATGT
TGGCAGAAGAATAACTGGTGGGGCTTCTCGTACGGGCCCAGATGCATACGAGGTTGCACTCAAACTTGAACATCGAAGAAGCAAAGGATGTAGTTATGGC
CCCCCGTTTGAGTGGCAGGTTTATCAGTCTCTCAATGGTTGTTATGGCATACCATCAGTCCACTACAAGGGTCGCCAGGGAGACTACTACATTCTTGTAA
TGGATATGCTGGGTCCTAGCCTCTGGGATGTTTGGAATTCAATGGGACAGGCGATGTCTTCTCATATGGTTGCTTGCATTGCCGTTGAGTCCATATCAAT
CCTTGAGAAGCTTCATTCCAAAGGCTTTGTCCATGGAGATGTAAAGCCAGAAAACTTTTTGCTTGGTCAACCTGGATCACCTGATGAGAAGAAGCTTTTC
CTAATTGATCTTGGTTTAGCATCCAAGTGGAAAAAAGCATCATCCAGTCAGCATGTTGAATACGACCAGAGGCCAGACATCTTTAGGGGAACAATTAGAT
ATGCTAGTGTCCATGCTCATTTAGGCCGTACAGGCAGTAGAAGGGATGATTTGGAGTCACTAGCGTACACCCTTATTTTTTTAATAAGAGGAAGATTACC
TTGGCAAGGCTTTCAGGGAGACAACAAGAGCTTTCTTGTTTGTAAGAAGAAGATGGCTACCTCTGCGGATGTTCTGAGTTGCTTCTGTCCACCTCCATTC
AAACATTTTCTTGAGATGGTCACTAATATGAAATTCGATGAAGAGCCAAATTATGCAAAACTTATTTCTCTCTTTGATAGTCTGATTGAAGTGCCTGCTT
CAAGACCCATCAGAATTGATGGTGCTCTAAAGGTTGGGCAGAAACGTGGAAGAATGGTTGTAAATCTTGAAGAAGAGGAACAGCCTAAGAAGAAAGTTCG
GTTGGGGAGCCCAGCAACTCAATGGATTTCGGTTTATAATGCTAGGCGGCCCATGAAGCAGCGATACCACTACAATGTAGCTGATTCAAGGTTGCACCAG
CATATTGAAAAAGGCAATGAAGATGGCTTGTACATTAGTTGTGTAGCTTCTTCAGCAAATTTTTGGGCTCTCATAATGGACGCTGGGACCGGGTTTGGTT
CTCAAGTGTATGAGCTTTCACAAATTTTCCTGCACAAGGATTGGATTATGGAGCAATGGGAAAAGAACTTCTATATAACAGCAATAGCTGGAGCAACCAA
TGGAAGCTCATTGGTTGTGATGTCCAAAGGAACTCCATACACACAGCAGTCATACAAAGTCAGTGAATCTTTTCCTTATAAGTGGATTAATAAAAAGTGG
AAAGAAGGTTTTCATGTAACATCCATGGGTACTGCTGGGAACCGTTGGGGAGTTGTCATGTCGAGGAATGCGGGCTACTCTGACCAGGTTGTAGAGTTGG
ATTTTCTGTATCCAAGTGAAGGACTCCATCGGCGATGGGAGAGTGGTTACAGAATAACTTCATCCGCAGGCACACCTGACCAAGCTGCTTTTATCTTGAG
CATACCAAAGAGGAAGCCACTGGACGAGACCCAGGAAACCCTTCGAACTTCTGCCTTCCCCAGTAACCACGTGAAGGAAAAGTGGGCGAAGAACCTGTAC
ATCGCCTCAATCTGCTACGGGCGAACCGCGTGTTGACGGCGTACTTGAGCTCGACGGCGAAATCACCCGAGTTTTACCACTGGAGCCAGAAGAGAGTTCG
AGACGGAACAAACTCAGCGTCAACCTTATTATCTAGGTTTCGAGCGCAATTGGCTGGGCGCTGACACTGGCCCGGCCTCTTTTGGTTGGCGGCACGCTAT
TCTAATTGTAAAGAATCTTGCGAAGATCCTTGGTGTTGTTGTATCAGTCCTCATCGGATGGATATGAACCTGTTGATAAGCTAAGGTCATATTATTGGCA
GATTTGCTGTTGCTCATTTTCGCAGCTCACCTGTAGCAATATCCTATGTGAGGAAGCTGCAGAGGCTGCTGTCAATCCCATGATGCAACTTTTGCTAACT
GACTCCAAAAGGTTTGGCACACAGCACAGCACACCTGGATCATGATTCAGTTGCTGTCAATCCATGATGCAACCTTTGGTAACCGACTCCAAAAGGTTTT
GGTACACAGCATACCTGGACGTAACCTAAGGGCTCCTTTGATTCAAAGGAATTTTATAGAATTTCTGAAGGATTGAAATCCTTAGGATTTTTTTCTATGT
TGCTCCTTTGATTTATAGGATTGAATCCCATAAGAATTTTTCCTATGGAATTTTTTGTACTACAT
page-top