Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23305  (registered. 2003)
Contig Information
Length 2224 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VABA Shoot with ABA treatment 4
Wh_VHS Shoot with heat shock treatment 6
Homology (BLAST) Top Hit hypothetical protein OsI_16800 [Oryza sativa Indica Group]
Score 3274
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23305
TACAGAGCGCATTCTCTATTACACTGGAAGGAACTACAAAATTGGTGAGGTTCATGAGGGAACAGCCACAATGGATTGGATGGAGCAAGAACAGGAGAGA
GGAATAACCATTACATCTGCAGCAACAACTGCCGTCTGGGACAAACATAGAATTAACATTATTGACACTCCTGGGCACGTCGATTTCACTCTTGAGGTTG
AACGTGCTCTCAGGGTGTTGGATGGTGCTATATGTCTCTTTGACAGTGTTGCTGGGGTAGAGCCACAATCTGAAACTGTGTGGCGCCAAGCAGATAAGTA
CGGAGTTCCAAGAATATGTTTTGTAAACAAAATGGATCGCCTTGGAGCTAACTTCTTTAGAACTAGGGACATGATAGTGGCAAATTTGGGTGCAAAACCT
TTGGTGATACAGTTGCCGATTGGTTCAGAGGACAATTTCCAAGGAGTTGTTGATCTAATAAGAATGAAGGCTATTGTATGGACAGGGGAGGAACTCGGTG
CACAATTTTCATACCAAGACATACCTGCTGATCTCGAAGAGTTGGCTCAAGACTATAGACTTCAGATGATCGAAACTATTGTTGAATTGGATGATGAAGC
TATGGAGGGCTATCTAGAAGGAAAGGAACCAGATGAGGCAACTGTGAAGAGATTAATCAGGAAAGGAACAATAGGTGCCAGCTTTGTCCCCATTTTATGT
GGTTCAGCCTTCAAAAACAAGGGTGTCCAGCCATTGCTTGATGCTGTTGTTGATTACTTGCCATCACCACTTGACCTGCCACCAATGAAGGGTACTGACC
CAGATGACCCGGAATTGATTCTTGAAAGACGTCCTAGTGATGATGAACCATTTTCTGGGTTAGCTTTCAAGATCATGACTGATCCATATGTGGGGTCACT
AACGTTTGTCCGCATATACTCAGGGAAGCTGATCGCTGGCTCATACGTTCTCAATTCAAACAAAGATAAGAAGGAAAGAATTGGAAGGCTTCTAGAGATG
CATGCAAACAGTAAGGAGGATATAACAGTTGCAGTGACAGGCGATATAGTAGCTCTTGCTGGTCTGAAAGATACAATTACCGGTGAGACACTCTGTGACC
CAGATAACCTTGTAGTGCTTGAACGTATGGAATTTCCTGATCCTGTCATTAAGGTTGCTATTGAACCAAAGACCAAAGCTGATGCTGATAAAATGGCAAA
TGGATTAATAAAGCTTGCTCAGGAAGATCCATCATTCCACTTCTCTAGAGATGAGGAAACCAACCAGACAGTTATTGAAGGAATGGGCGAATTACACCTT
GACATCATTGTAGACAGATTAAAGAGAGAATTCAAGGTTGAGGCAAATGTTGGAGCTCCACAGGTCAACTACCGTGAAAGTATTTCCAAAATTGCAGAGA
TTCAGTATGTCCACAAAAAGCAGTCTGGTGGTTCAGGGCAGTTTGCAGATATTATTGTGCGGTTTGAACCTATGGAGGCTGGAAGTGGGTATGAATTCAA
GAGTGAAATTAAGGGAGGGGCAGTGCCAAAAGAATACGTACCCGGTGTGATGAAGGGAATTGAAGAAAGCTTACCTAACGGTGTCCTTGCTGGTTACCCA
GTTGTGGATTTACGAGCAGTGCTGGTTGATGGCTCCTACCACGATGTTGATTCAAGTGTCCTTGCATTCCAAATTGCAGCCAGGGGGGCCTTCCGGGAAG
GATTGAGGAAAGCTGGCCCACGACTCCTGGAGCCTATAATGAAGGTTGAAGTGATTACCCCTGAGGAGCATTTGGGTGATGTTATTGGTGATTTGAACTC
TAGAAGAGGGCAAGTTAACAGCTTCGGAGATAAGCCAGGTGGACTGAAGGTGGTTGATGCTTTCGTGCCACTTGCCGAGATGTTCCAGTATGTCAGCACT
CTGAGGGGAATGTCCAAGGGGCGCGCGTCGTACACAATGCAGCTTGCCAAGTTCGACGTTGTCCCACAGCATATCCAGAACCAGCTTTCTGCGGCAAAAG
AGGAAGCTGCTGCTTAAATGTTCATTATTCGTAGATAATATATATGAGGACGGCAGAGCAGGTGAGTATAGGACATCAATGTGTATGTAGCTTTGTAGTG
TCGAACCCAGTGGGTGATATTATTTGCCATTGTTTTTGGACCTGATAATGTCCATAATTTTGCAAGCTGTTATAATTTCATAATGACCTTGTCAAGTTCT
CACAAACGAGAAAACCAGTTCGTT
page-top