Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23275  (registered. 2003)
Contig Information
Length 415 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 6
Wh_SHDr Shoot grown with dessication 2
Homology (BLAST) Top Hit similar to Dictyostelium discoideum (Slime mold). Phosphatidylinositol 3-kinase 3 (EC 2.7.1.137) (PI3-kinase) (PtdIns-3-kinase) (PI3K) (Fragment)
Score 75
Evalue 5.97761
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23275
CGGGTTCGTCCACACACTCCCGCCGCCACCACCGCCGCGAACCGGAGAGCGAGGCCGACACCGCCGCCGCGATGAGGGCCAAGTGGAAGAAGAAGAGGAT
GAGGAGGCTCAAGAGGAAGCGCCGAAAGATGAGGCAGCGATCCAAGTAGGCCGTAAGCATCATCTTGCATCCAGGCAGCGGAACTCTGAGGGGTGATGGC
ATTGTCTAGTGATTCTTGATTTGTTCTGTTGTTTTGGCTGTGGAAGTTGCTTTTACCTGTGTTTGGTCAAATTTAGTTGTTTAATACTAGTCTGGCTATG
TTCCAGTACTGAGTTTTATGTAATGTGAGGATTATATGTGTTTGTGACTGAATTTTATGCACCTATTATCCTTGAGGTACTCTGAAATGTGCCTTTTGGC
CCTGCAAAAAAAAAA
page-top