Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23272  (registered. 2003)
Contig Information
Length 1476 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 5
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 3
Wh_VWD Shoot grown with dessication 6
Homology (BLAST) Top Hit 26S proteasome non-ATPase regulatory subunit 4 [Zea mays]
Score 1181
Evalue 2.88551e-127
Total Hit Count 224
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23272
ACCCGAACCCAACCCTCGACCGCAGCGACTCACAGCGGCGCAACCATGGTGCTCGAGTCGACGATGATCTGCATAGACAACTCGGAGTGGATGCGGAACG
GCGACTACTCGCCGTCCCGCTTCCAGGCGCAGGCCGACGCCGTCAACCTCATCTGCGGCGCCAAGACCCAGTCGAACCCGGAGAATACGGTGGGCGTCAT
GACGATGGCCGGCAAGGGCGTGCGCGTGCTTGTCACCCCCACCAGCGACCTCGGCAAGATCCTCGCCTGTATGCATGGGCTGGAAGTTGGAGCTGAAGCA
AACTTGGCCGCGGCTATTCAGGTTGCTCAGCTGGCGCTAAAGCATCGCCAGAATAAGAGGCAACAGCAGAGAATTATTGTTTTCATTGGAAGCCCTGTGA
CATACGACAAGAAGGTCTTGGAGACAATAGGGAAGAAGCTGAAGAAGAATAATGTTGCCCTTGACGTTGTTGATTTTGGTGAAACTGATGATGAAAAGCC
TGAGAAACTGGAAGCGCTGATCGCTGCTGTGAACAGCAGTGATAGCAGCCACATCGTCCACGTCCCTCCGGGTGACCATGCCCTTTCTGATGTTCTTATA
AGCACTCCTATCTTTACTGGCGAAGAAGGTGGAAGTGGCTTTGCTGCTTCTGCAGCAGCTGCTGCAGCCACCGGAGCTACTGGATATGATTTTGGCGTGG
ACCCAAATGTGGACCCAGAGTTGGCACTTGCCCTACGGTTGTCTATGGAGGAAGAGCGAGCTAGGCAAGAGGCTATCGCGAAAAAGGCTGCAGAAGACAA
CAAGGATCAGCCCTCAAGCTCTACCGATGCTATTATGGCTGAAGCGGAACTTACCTTAAATGCTCCTGCTGATGTTGACGCAGATCTACTCAAGGATGAT
GATGATGCTCAGCTACTACAGCAAGCACTTGCTATGTCAATGGATGAGGGTGCTTCAGGAGCTGCAGCCGTGGCTGATGCTGCTATGGCAGAAGCTGCTG
CAGATGACCAGGATTTGGCATTGGCTCTTCAAATGTCTGTCCAGGACGCTGAGGCGGCTGGTCAATCTGATATGAGCAAAGTGTTTGAAGACAGATCATT
TGTGACATCCATCCTTAATTCGCTTCCTGGTGTTGACCCCAATGACCCATCTGTGAAAGATCTACTGGCATCTTTGCATGGCCAAGGAGAGCAGGAGGAG
AAGAAAGATAAGGAGGACAAGCCAGACATTTCTGAAGATGGGAAGAACTGAAGGCAATGAACATCTATTTTCTCGGAAAAGTGCAGGCGCATGAAATGAA
GAAGATTGCCTGCATTAGCTGCTTTTACACTCGGGCTCTATGAATTTACTTAATCCTCTTGTAACTGCGTTGATGATAACTGCCGAGAGAACTTGTATTA
TGTCTGCTCTCACGAATGCTCCTTCATGTTTGTCTTAAGTGATTACATGTTGCAAATTCATTTGTACACTTTATGT
page-top