Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23251  (registered. 2003)
Contig Information
Length 1458 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Wh_VSCB Liquid cultured tissue 10
Homology (BLAST) Top Hit alcohol dehydrogenase ADH2A [Triticum aestivum]
Score 1926
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23251
GCAAGCAGAGACAGCGACAGAGATCCATCTTCTTTCTCTTCGAGTTCTTGGAGCTAGCGACCGACAGGGACAGCGATGGCGACCGCCGGGAAGGTGATCA
AGTGCAAAGCGGCGGTGGCATGGGAGGCCGGGAAGCCGCTGTCGATCGAGGAGGTGGAGGTGGCGCCGCCGCAGGCCATGGAGGTGCGCGTCAAGATCCT
CTACACCGCCCTCTGCCACACCGACGTCTACTTCTGGGAAGCCAAGGGGCAAACTCCGGTTTTCCCTAGGATCTTGGGCCATGAAGCTGGAGGCATTGTT
GAAAGTGTCGGAGAGGGTGTGACGGAGCTAGTGCCGGGCGACCATGTCCTCCCGGTGTTCACCGGCGAGTGCAAAGACTGTGCCCACTGCAAGTCAGAGG
AGAGCAACCTTTGTGACCTCCTTAGGATCAACGTGGATCGTGGCGTGATGATCGGGGATGGGCAGTCACGCTTCACCATCAACGGGAAACCCATCTTCCA
CTTTGTCGGGACCTCCACCTTCAGTGAGTACACCGTCATTCATGTCGGTTGCCTCGCCAAGATCAACCCTGAGGCGCCCCTTGACAAAGTTTGTGTTCTC
AGCTGTGGTATCTCAACTGGACTTGGTGCTACCCTCAATGTCGCGAAACCGAAAAAGGGTTCCACGGTGGCCATATTCGGTCTTGGAGCTGTAGGCCTTG
CTGCCATGGAAGGGGCCAAGATGGCTGGGGCAGCAAGGATCATTGGTGTGGATTTGAACCCTGCAAAATACGAACAAGCTAAGAAATTTGGATGCACTGA
CTTTGTGAACCCAAAGGACCACACCAAGCCAGTGCAAGAGGTGCTTGTCGAGATGACCAATGGCGGAGTCGACCGTGCGGTTGAGTGTACTGGCCACATC
GACGCCATGATCGCCGCCTTCGAATGTGTCCATGATGGGTGGGGCGTGGCGGTGCTGGTGGGCGTCCCACACAAGGAGGCGGTGTTCAAGACAAGCCCGA
TGAACTTGCTCAACGAGAGGACCCTGAAGGGCACCTTCTTCGGCAACTACAAGCCGCGGACCGACCTCCCGGAAGTCGTGGAGATGTACATGAGGAAGGA
GCTGGACGTGGAGAAGTTCATCACCCACAGCGTGCCCTTCTCGCAGATCAACACGGCGTTCGACCTCATGCTCAAGGGGGAGGGCCTGCGCTGCGTCATG
AGGATGGACGAGTAGATCGCTTCTTATCCATCGTTTTAACATTTGGTGCTTGAGAAGCACAGGCAATTTTTTTTAGAAAACCTCCGTCGGGTAATAATCG
TGTGTGCTAGTCGTGAGATGTGCATGTGTTCATCTCTATGCTCTTTGTTTAGTGTTCACGGTTTGGTCTTTGGTTTCATTGTGTCTATCGGCAGCTTTCA
GTTGGCATGTAAATTACTATTAATAATTGTGTCCCAACAGTAATACTAGCGTGCAATT
page-top