Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23245  (registered. 2003)
Contig Information
Length 1489 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VABA Shoot with ABA treatment 9
Wh_VHS Shoot with heat shock treatment 2
Homology (BLAST) Top Hit Os05g0208000 [Oryza sativa (japonica cultivar-group)] >gi|53749331|gb|AAU90190.1| putative 2-oxoglutarate/malate translocator [Oryza sativa (japonica cultivar-group)] >gi|113578455|dbj|BAF16818.1| Os05g0208000 [Oryza sativa (japonica cultivar-group)] >gi|125551229|gb|EAY96938.1| hypothetical protein OsI_18855 [Oryza sativa Indica Group] >gi|215701101|dbj|BAG92525.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765355|dbj|BAG87052.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1269
Evalue 1.82361e-137
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23245
GTATGTGACATGCCAAGAAAAATACAACAACAACGAGAATTGACTACACATTTTACCCCGCCAAAAAATACATGTCGACACTTGACAAACATAAGGCCTA
AACAAATATATACTGAAAAAGGTTGTTTGATGTCCGGCTCCATTGATGAGATGGGTTCAATCCGGTGGTGGCATATCCGCTCCTAACAACTCTACTTTCA
GCCAAGAGTTACCCAGAAATGATATGATTATTTGGTCTGAAAGACACAAAGAACAATGGTAGCATATAGGCCAAGGAGATAAGTACAGATTTTGTTTATC
AGAAGCAACTGCTGGTTTATAGGTACAAAGCAGCTACACTATTATAATTTGTCGGCAAGGATAGCATAGCACAGCACTTTAAAGGCCGACACGCTTCTCG
ACCTTCTGAATCTGATTCAAGAATATCCAAGTCATCATGACATGTGGAGCAATCCTGACACAGTAGACCGGAAAGCCAGTGTAGAACTTAAATGGACCAC
CACTCTTCAAGGTCTTCATTGCACAGTCAAGAGACCCAGTGTATGGATACTTTCCAGTAGCATCAGGTTGCATCTTCTGAACCTGTGTCTTAACATAGTC
GAAGGGCAAACTGCAAGCAGACGCGAAGAATCCTGAAACAGCACTGGCCCCAAGCATTGTAGAAAGTTCACCAGCACCAAGTTTGTCTCTAAGTACCTCA
ACACTCTGATCATAGGAGGCAAGCATGCCCATGTTTAGTGACATCGCTCTAGCTACAGTTGGACCTGCGCCCTTCCAAAGTGCCAGAACACCTTCATCAG
CAATAATACGGTAAAGTGCATGAAAAGCATTCTTATAGTGGCGGCGCTGGGCTGCTGGCAAGGTTGAATCAGCCTGCATCCTAATGAGTGCCAAATCTGC
AGGACTACCAAAACACGCTCCAATCGCTCCAGCAGTGAGACCAATAGCAGCCTTCTGGACTAAGGGCAGTGGTTTTCCTTCGTTTGCTTCAACTGCTTTA
TTTGTTAGAACCCTGAAGGATCCAAGTCGAGCGGTTGTGTATGTCGCTTGCCTTAGCAAGCCAGCAGATAATCCCTTGTAAAAGGAACCAACTCCCTCAT
TAGCAAGCATCTTCTTGGTGACAGAAGTTGCAGAGCCCTCGCCCAACTGGATCTTCACCTTGACCATGTCGATGGGCTGGATGACGCAGGTGGCGAGCAT
GCCGGAGGCGCCGCCGTTCACGAAGGGCTTCACCGTCTTCCAGACGCCGCTGGCCGCCAACGCCGTCTGCGGCGGCTGCTGCTGCTGCTTCGCATCCGCC
ATCTCCTCCGCCTCGTATCAACTCCCACCGATCCTGAGCCAGGAGGAGCTCCCGCGCTGCTGCCTGGGCTTCCGGAGAAGCAGAGGTGGTGGGAAGCAGA
GGACTGTGAGGCGACGGGGACGTGTGGTATCGCGGCTGGATACCTCGGCGTGAGCCACGAGCCCACGGGCAATTTCCCCTCGTCCGAAT
page-top