Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23235  (registered. 2003)
Contig Information
Length 1364 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 6
Wh_VHS Shoot with heat shock treatment 1
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1415
Evalue 1.9072e-154
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23235
TTTTTTTTTTACTCTAGTGAAATCAACAGAAACAAAGCGGACGATACACAAGTCGCCATATACAGTAACATGCAGTTCTAACCTCAGCCAGTCGGCCTGC
AGGCTAGCTACCACAGGTAGTAGATTCTTACACAACGAATAAAATGCCGATTCAAGTATGACTATATAAAACCAATGCCAAGGAATGTAAAGCATGATGA
CGTCCATGTCTCTTCATGGGGGCCAAGTGAAGTGATTTACAGGAACACGTCCTTCTCGAGCAGCTTGAGGACCTCGTCCTGGTTGTTCAGCTTGGCGACG
TCGATGGGCGTCTTCCCATCCATGTTTTGGAGAGTGACAGCAGCGCCGTGCTTCAACAGAAGATCCACACACTCTTTCCGGCCATAGCCAGCAGCGTAAT
GCAGTGGGGTGTTCTTGTTCTTATCCATGGCATCTACAGCAGCGCCCGCCTCAAGGAGGATTTCCGCACACTTGAACTCACCATATCCACATGCAAAGTG
CAAGGCCCTTCTTCCCTCAGAGTCTTCTTCATCCTTGTCTGCTCCACCATCTAGAGCCTTCTTCAGACCCTCACCGTCACCAACACTGGCAGTGTGGTGG
ACAATGGACTCGTCTTCATCTTCACCTTCTTCTTCAGTTTCTTCAGTACCAGAAGGTTCAGCAGTAGAGACAGTGCTAAATGGCATCGTAGTTCCCATTG
CCTGGCCAATCTTTTGAAGAGTTTCAGGGTCATTCCAGTACTTTATCATTGCAGCAGGACCACCATTCTCTAACTCATCAAGAATTGGCTTCAAGGCTGG
ATCGTCCTTAATCCGAGACATGCGCTCTTCAAGCTCCTCCTTATGTGATGGACTAGTCAAATTTTCCAGCATACTGGACATAGCAGGATCCTGCATAAGA
GCAGTCCCGAGGCGCTCTGCCATTGTCATAAACTGAGGGTTTTCCATGACCCTTTGCATTGTTTCCATGTATTGATGAGGATCCAATGGAGGCATGCCCT
GTTCTCCTGCAGTCTGAGCACCTTTCTGTAGCTGCTCAGCCATCTGATTGAATGCAGGGTCCCTTGCAATCTGATCCGCCATCTCCTTTATAGACGGATC
ATTGAGCAAACTTTGCATAGAAGAAAAATCGAAAGGACCCGACAAGCCTGCAGCAGCAGCTGGAGGAACCCCTTGACCTTCGTTGGATGATCCTTCTGTT
TTTTTACTTTTGCTCTCATCAGCGAACCCGGATGGGGGATCTCCACCCGACGCCATCCCGGTAGATACGAGGGGTAGGGGAAGAAGAATTCGTCCGAGGT
GGGCTGCTTGCGTCGGCCGGAGGCGGAGCTCGGCGGCGCGGTGGGGGAGGAGAGAGTGCTGCCA
page-top