Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7663  (registered. 2012)
Contig Information
Length 1298 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_DPA20 Seed DPA20 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 1
WH_XA Root 1
WH_XB Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242096638|ref|XP_002438809.1|| hypothetical protein SORBIDRAFT_10g026570 [Sorghum bicolor]
Score 475
Evalue 5.00E-132
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7663
GAGCACCGCCGGTATTCCGCTCCCGAATTCCACAGATTTCCACTCCCCGCTCCCAAAGCCCCGAGACTTTATAGCCGGCGAGAACAAACCCAGCAAAATC
CCATCTCCCAACCCAGAAATCCTCCCACACCCAGAAATGAATCAGCCTCTCCTTCCCCTTCTCTGAGATCTCAGCCTGAGCCTGCGCGCCGCGACTTCCA
CCGGAATCCTCCTCTCCCAGCCGCAGCGTCGCCGGATTGATTCAGGAGGCATTCTTGCCGGCCGGAGAAGCAGTCTTTGGTCATCTGCTCGAGAAGAATA
TAACAGAGGCTCTAGTTCAGATCATCATCAGACATGTCGCTGCTATCGAAGTTACGGTTGGTCACTGTGGATGTGACTGGTACTCTGCTTGCTTACAAAG
GACGGCTTGGTGATTACTACTGCATGGCTGCTAAGTCTGCCGGAAAGCCATGCCCTGACTATGATCGAATGCACGAAGGCTTCAAGCTTGCATACACTGA
GATGGCGAGGAAATACCCATGCTTTGGATTTGCGGCAAAGATGCCAACGATTGAATGGTGGAGGATTTGTGTCAAGGATTCATTTGTTAAGGCTGGCTAT
GATTACGATGATGAGACATTTGACAAAGTGTTCAAGCGTATTTATTCCGCCTTCGGCTCCTCCGCACCATACTCGGTGTTTCCTGATGCACAGCCCTTCA
TGAGAGGGCTGAGGGAGAAGGGTATCACAGTTGGCATCGTCAGCAATGCAGAGTACCGTTACAAAGAGGTCATCTTGCCTGCGTTAGGGCTGAATCAGGG
CTCGGAGTGGGACTTCGGGGTGTTCTCAGGCATCGTCGGCGTTGAGAAACCTGACCCAAAAATCTACAAGATCGCGCTGGAGATGGCGGGGAACGTCGCA
CCGGAAGAGGCGCTCCACATCGGCGACAGCTACCGCAAGGACTACGTCCCCGCACGGAGCATCGGGATGCACGCGCTGCTCCTGGACCGGTTCAAGACCG
CCGACGCCGAGAGCTGGAGGAAGTCCGGCGCGCCGGTGCTCCCTGACCTCGAGGCCGCGCAGGCATGGCTCACCAAGAACCCGACCGAGGAGCCACTAGG
GGCCGCGCTGCTGCGCAGGATGGCCGAGAAGCTCTGAATCTCGCCCCCTGGGATAGTTCCTGTTGTGCTCTTGCTGGGGAGTGAGGGAGCCAAGGAGAAG
GGATGTGTTGTAGTGATGGTTCACTGGCCAGTTTAGCTAGCTGGAGCTACTTGAACTCTGGTAGTAGGCTTCCGGTGCTGTGGTGACTGCTGAATGTG
page-top