Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23146  (registered. 2003)
Contig Information
Length 906 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 2
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195608846|gb|ACG26253.1| NADH-ubiquinone oxidoreductase 13 kDa-B subunit [Zea mays] >gi|195637862|gb|ACG38399.1| NADH-ubiquinone oxidoreductase 13 kDa-B subunit [Zea mays]
Score 771
Evalue 4.87343e-80
Total Hit Count 128
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23146
CATTTTTCACTTTGCTGCTCGCTCCTACACTAACCCACACGCACGGTCGCACCCGCACCTCACCTCATCTCACCAGAGAGAAAGAGAGAGAAGAGAGAGA
GTCCGAAGAAGAAGACGGCGGCGGGATGTTTCTGCGGCGGATCCTAAGCGGCGGGGGCGGGCTGGCGGCCATGCGCTCTGCGCGGGCGGTGAAGGAGACG
ACGGGGATCGTGGGTCTGGACGTGGTCTCCGAGGCGCGGGATGTGCTCATCGGGCTCTACACGCGCACCCTCAAGGAGATCGAGGCCGTCCCCAAGGACG
AGGGCTACCGCAAGGCCGTCGAGTCCTTCACCCGCTACCGCCTCCAGATCTGCCAGGAGGAGGAGGACTGGAAGCGCATCGAGGACCGCCTCGGCTGCGG
CCAGGTCGAGGAGCTCATCGAGGAGGCCGAGGACGAGCTTAAGCTCATCGGCAAGATGATCGAGTGGGATCCCTGGGGTGTTCCTGATGACTACGAATGC
GAGGTGATTGAAGATGACACACCTATTCCCAAGCATGTTCCGCAGCACCGGCCCGTTGCACTACCTGAGGAGTTCTTCAAGACATTAGATGCCATCAAAT
CAGATCCAGCTCTGCAGGGCGACTCTCCTCCGCAAGTGAAGTCATGAAACTTGAACTCTTCAAGATGCATCATTTTTCACCTGCCGCAGTGTGTAGTTGA
GACTAGTCTCATGGGTCCTTTGCCTGCAGTTTGCTTGTTGTCCTGAGCAGAATAAATTTGTTTCTGTGAATGTGAATGCGTTTTTAACGCAGTGCTTCAA
CACAGTAAAATACTGTTTCTGTTTTCTATTAATCGATGTTGACAAAAGATCAAATGCTGGTTTGTTTTATACTTTTTCGATTCATGTACTTCAAGAACCC
TGCACT
page-top