Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23139  (registered. 2003)
Contig Information
Length 1266 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 5
Wh_PCDAM Anther at meiosis 6
Homology (BLAST) Top Hit MTN3 [Zea mays]
Score 953
Evalue 6.39717e-101
Total Hit Count 323
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23139
GCCTTCCTTCCCTAGTCTCTGGGAAGGAGAAGAACACACAGCAGACACATCCATCTGATCTGCTTAGTTTAGTTATCGTGCTTTGTACCCGTGATCAGGA
TGGCAGATGGGCTCTTCTCCATGGCTCACCCGTGGGCCTCCGCCTTTGGCATCCTAGGCAACATCATATCCTTCCTGGTGTTCCTCGCACCCACGCCGAC
GTTCCTGCGGGTGTACCGGAAGAAGTCGACGGAGGGGTTCAGCGCGGTGCCGTACGTGGTGGCGCTCTTCAGCTGCATGCTGTGGATCTTCTACGCGCTG
GTCAAGACCAACTCCAGCCCGCTGCTCACCATCAACGCCTTCGGCTGCGTCGTCGAGGGCTTCTACATCCTGCTCTACGTGGTGTACGCGCCCAGGGCCG
CCAGGCACCGCGCCCTCGCCTTCTTCCTCCTCCTCGACGTCGCCGCCTTCGCCCTCATCGTCTCCGTCACCGTGTTCCTCGTGCCCCAGCCCAGCCGCGT
CAAGGTCCTCGGCAGCGTCTGCCTCGCCTTCTCCATGGCCGTCTTCGTCGCCCCGCTCAGCGTCATCTTCGTGGTGATCAAGACCAAGAGCGCCGAGTAC
ATGCCCTTCTCGCTCTCCTTCTTCCTCACCCTCAGCGCCGTCGCCTGGTTCTTCTACGGCCTCTTCACCAAGGACATCTACGTCACCCTCCCGAACGTGG
GCGGCTTCTTCTTCGGGGTGGCCCAGATGACGCTCTACTTCTGCTACCGCAAGCCGGACACGTCGGCCCTGGTCCTGCCGACGGGGATCCACGACGTGTC
CACGGAGACGGCGGCGCAGCAGGAGGTGGAGCTCCCGGAGGGCACCCACCCGGCGGTGGCCATGCTGACGGTGAGCACGCTGCCGATGCTGGCGGAGCTG
CAGAAGATGGAGCAGGAGATCAGCTCGCCCACCCCGCGCAAGGGCTACATCAAGGCATTCTGATCCGATCCACGACCCATGCGTACGTACGTGCGTGGAG
CTACCTGCTGCTTCACGCGCTTGGCTCACCATGGATGCTTAATTAGCGATGAATCGCTAACGATTTGCGAACCGACCGCCAGCAGAGATACGTTTATATA
GTTCTTAATTTCAGTCGTTCGTTTGTAATGGTCCGTAGTAGTGGCACATTCGTGTGTTGTCGTCCAAGGGTCTGATATGCCGGCCGGCCGGGCAATTAAC
TGATCTACCATTCCACGTGCCCTGGGAAATAAAGTTATAAACAGAAGCTCGTGTTCAAAAAAAAAA
page-top