Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23129  (registered. 2003)
Contig Information
Length 737 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 1
Wh_VWD Shoot grown with dessication 3
Homology (BLAST) Top Hit plasma membrane intrinsic protein [Hordeum vulgare]
Score 655
Evalue 9.53114e-67
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23129
TTTTTTTTTTATTTGGGATGATCACTTGCTTGGTGGATTGATGACTTAGATAGAAAGGTGGCGACGTTGGATCGATCATACATATGGTCGCTAAATTTAA
ATACAAGTAGGAAAAGCAATGCGGGCTAATTAAGACAAGCGATCCCATGGACCGAATTACAAGACACGGCACGCATGACCGGACCACGTACTACGCATAT
GCAGCTGCCGACACATAATAACACGACCATTGCGGCGGCCGAACTGAACTGTCGAGAAGTTGCAAAAGCGCATTTCTCTCTGGATGGATGGACACAACAC
GGGTCGCCATTGCTTCAGTCTTGCATACAGATGACATGGATGATAACTTGTTACGCGTTGCTCCTGAAGGAGCCGAGGGCCTTGATGGCGCCGGCCCTGA
GGATGTACTGGTGGTAGAAGGCCGCGATCGCCGCGCCGATCATGGGGCCGACCCAGAAGATCCACTGATCATCCCAGGCCTTGTCCTTGTTGTAGATGAC
GGCGGCCCCCAGGCTCCGGGCCGGGTTGATGCCGGTGCCGGTGATGGGGATGGTGGCCAGGTGGACCATGAACACGGCGAAGCCGATCGGGAGGGGCGCC
AGCACCGGGACGTGAGAGTCGCGTGCGCTGCGCTTGGGGTCGGTGGCGGAGAAGACGGTGTAGACGAGCACGAAGGTGCCGATGATCTCCGCAGCGAGGC
CGGTGCCCTTGGAGTAGCCGGCGGCGANCGTGTTGGC
page-top