Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23123  (registered. 2003)
Contig Information
Length 1420 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 3
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 2
Homology (BLAST) Top Hit Os06g0486400 [Oryza sativa (japonica cultivar-group)] >gi|51535448|dbj|BAD37346.1| putative oxidative-stress responsive [Oryza sativa Japonica Group] >gi|113595705|dbj|BAF19579.1| Os06g0486400 [Oryza sativa (japonica cultivar-group)]
Score 1404
Evalue 3.77194e-153
Total Hit Count 344
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23123
TGTAGTTGACGGAAACTAATCCTCACCGATAACACAAAGCATGCTGTACAAATCAAAGATTATACTATAATGTGAACTCGCTAAAATACTTACAATTACA
ATTGATACAACTACCTGATTTCGAAACATAATACAATTAATTTCACTAACCAGGTCCAAAATTGGGGAGCTGAATTATACAACGGGGACTTAGGGGGGAA
TATAATATATCATTGCTTGGTACTACCCTCTCTTCGCAACCTTTCGTCTTTTTTCGACAACCCGTTGATCTGCTGCTCAAGCTGATTATTTCTCAGCTTC
AATCTCTGCACTTCCTCAGAGAGTTCTGTGACACTTCGCTGTAGTTGGACGACATACGACTCCAATCCCTTCTCTCTGGCAAGCGATCCAAATGACTGAG
ACAAACCAACTGTACTTGCATCGGAAGCATCAGATGTTTCCTCAATTGAAGAAATCAATCTACTTAGCACTTCCTTTTGCATAGAATTTTGCTGCATCAA
GAATTGTAGTGTCGGTAGAATTGTGGATGAATTGGAAGCTGGCCGTGTTACTCCACTTGGTAAATTTGGCCTGCTGTTGCTGCTTGCTGATGAAGCTACC
TTTTGACCAGGATTATCTGATGTGACCTGAAATCGCCCCCTTCGCTGGACAACATTTCCTTCCGACGCCTCATCGGGTGCAACAGACAGATGTGGGCGTA
TGTCCTTCATTTGACGGAAAAACAAAGGGCCACTTCGGTTTCTGCTGCTCGGATTTTTCTGATGAAAGTCATTCCTTCGTGAATCACTACCAACATTCTT
GTAAGGCGAAAGAACATGCTCGGGAATAAGAGAACCACTTGAGAACTTGGGATATACACTATTTCCCAAATTTGAGGGTACGGAGACACTTCTTTCCAGA
TTTTCACCATTACAGTTGTCACTTCTACTATGGTCCATTTCTGAGAACTGCTGCACAGGTGATATAGACTCCATGCTTGGTTGTACCCGCAAATTCGTAG
CAGTAGGGTCCGGATCATCATCACCGCCGACATCAAAGCAAGACTTTAGTGCCTCAAGGGGACGGGTTGGAAAGGAAGAGGCAAGATCTCCATCCAAATC
TTCTACTTCTTGTATCTCATGCTCATCATGCCTTGCAGAAGCACCATGGTTAACCCTTTCCTGATAAATATTTTCTGATTCATTATAAACGTCTTGTAGC
CCATTCCTATCTTTGTTGTTGGCACCATCAAAATGGTATGTGCCATTTGAACTGTCTAGAAGGGCAGCTGCGGTTTTCAAGTCCTCCAGATTAAAATTCC
AGCCACTGATGCCCCTTATGTATTCTTTCTGTGATAACTGCTCCTTGCTCTCTGGACCAAGCTTGTTATTGAGAAGTAAGTCAGCCTCTTTTGCCTTCAA
CGCCCTAAAGCGGTCGCCCA
page-top