Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23061  (registered. 2003)
Contig Information
Length 686 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 4
Homology (BLAST) Top Hit RecName: Full=Histone H2A.2.2
Score 506
Evalue 1.55968e-49
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23061
TTTTTTTTTTCAGTTCAGAAACGCTTAGTTGATAATTCATAAGTCAAGAGGAAGCAAGCGGCTTCCCCTTTGTTCGCGATTACATCAGGGGCGCAGGATA
CAGAGTGAAGCAGCTACTACATCTAACCAAACTCGAACAATCAGCACACCGCACTACTACAATCTACGCCTTGGTGGCTTTCTTGGGGGACTTGGTGGCC
TTCTTGGGCGACTTGGCGGCGGTGCCGGCCTTCTCAGCCTTCTCGGCGGCCTTCTTGGGGAGCAGCACCGGGTTGATGTTGGGGATGACGCCGCCGTGGG
CGATGGTGACGCCGGACAGCAGCCTCCCGAGCTCCTGGTCGTTGCGGATGGCCAGCAGCAGGTGCCTGGGCACGATGCGGCTCTTCTTGTTGTCCTTGGC
GGCGTTCCCGGCCAGCTCCAGCACCTCGGCTGCGAGGTACTCGAGGACGGCGGCGAGGTAGACGGGGGCGCCGGAGCCGACGCGCTGGGCGTAGCGGCCC
TTCTTGAGGAAGCGACCGATGCGGCCGACGGGGAACTGGAGCCCGGCCTTGACGGACCTGGTCACCGACTTCTTCCTCGGCCCGCCGAACTTCTTCCCGG
CCACCTTCTTCAGCTTGCCGGCGTCCATCTTCCTTGCTTGCTCCTTGCTGGGGCTCCGGCGAGAGGTGGAGTANGTGGGATTGATT
page-top