Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23054  (registered. 2003)
Contig Information
Length 1514 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 6
Homology (BLAST) Top Hit hypothetical protein OsI_04777 [Oryza sativa Indica Group]
Score 1741
Evalue 0
Total Hit Count 118
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23054
ATCTGCTTGCGCCCCTCTCTTTTTTTGTGCATGGTGTGGCATGTACAAAAATTTCAAGTGAAGTTCTGCTAGCATTTCTCTCTATTTTTGGTGAGAGGCA
ATGAGACTGGACCAATAACTGAAGACTTCTGCTAACAACTGTTTAATATAAACTGCTGCTTATAAATTTACAATGCCGGTCGTCGTCACGGCGGCTCATG
GTACCATTACTAACATAAAAAACATCAATTCACCAGACTGACGGCGAAGTGGCTACGGATCCAGTTCACACGCTCACAGGGAGCTTCTCATGCTTCGGAG
GCAAAACTGTCTGTCTTGGTGGACTCCTCCGCATCAGACGGCTTCGATTCGTGCATCGCTGCCGCTTTGAGAACTCGGTCCTGCACCGCCGTCGTGGAGG
GGGACGTCGCCAGGCCAATCTTGTTCGGCTCTAGCTTCTTAGCTGCCCACGAGAACGCTTCCGCGCCCACTCTTACTGGGGACAGCAACAGCTTTAGGTC
TTGCAGGAAATCCTCCGAACCCTCGTATGTAGAGAACCGCAGGTAGATCGTCAACCCAATACTAAGAACACCGATGTACTGCAAAGTCGTCTCCCATTCT
AGCAAAGCATAAGTCACTGCTGAGAAGCCCAGAAGGGATCCAAGGACAAGTGTAGGGGTGGGCTTTATGCCTTCGAGGATTTCCTCAGCATCCTCATTTA
TTACTGTCAATGCAGTCTCTGGTTTCAGTTCTTTCACGCGAAGATTCTTTGCCCAAGATTGGAAACCTCCTTTAACCAGGTAAGGTTGCTGAACACCAAG
CTTCTTCAGCAGCCTAGCAATGGACTTTGATCGGGTTCCATTAGCATCCATAATAATGACCTTTGAATCACCCTTAACCAACTTCAAGTTGCGGATTACA
ACTGCAACCAAAGCATCATCAACTTCGCTTCCACCTTTAAGTAGCTTCTTTGTTGGACCTTTGATCTCAGGCGAAGCAACGCTTGCATATTTAGATCTAG
CTGCACGGCGTAGGTCAGGAATTCCATCTTTCCCCCTCAAGTCCTCAGGCCGAACATCAATAAGTACGGCTTTGCCATCACTTTTCAATAGCTCCAATGT
CGATTCAGGCGACAAATCTCCAGAATAGCCACCATATGCGAAGAGCCAGTAAGATATCCCTATTGTTGTTGAACCTCCAAGCAAAACTGCCAATTGAACA
ATTGGGTCACTTGGGTTCAAACCAACATTCTTTTCGATGCCTTCGATGATAACATATACCTGTTGAAGGGCACCTCCAATTGGTCGCAATACTATGCTAG
CTTTCTCCTCGGATGAGTTCAGCAAATCTTTGACATTTGGTGGCAACGACGACTTGGCCGAGCCATAGTAGTATACGAGGGACGTGGTGGCACTGCCCAG
TGAATCCTCTGCTACAACAATTGCCTTCCTAAGAACGTCAGCCGCCACGGCGCCAGCTCCGGCCACCTTATCCTGAAATGCGCCGGAAACGTCCGGGACC
CCACCGGCGGCCTG
page-top