Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23035  (registered. 2003)
Contig Information
Length 1573 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 4
Wh_VWD Shoot grown with dessication 1
Homology (BLAST) Top Hit putative cellulose synthase [Triticum aestivum]
Score 2094
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23035
TTTTTTTTTTAAAACTCCTCCAAAATGTGAAGGACAGGAATAATTTATATAAATAATAAATACAACATTTCATAGGTCCATTCCTACAATCCAAAGTGCC
TCATAGGAAAATTCCTATAGGTTTACCAATGAGATTCCTTTGTTCCAAAAAAAGAAGAGCTTAACCTCATGAAAACGGTAGATGGTCTATTACATCTATT
TACAAATGTGTTTTCTCAATTTTGACAACTTTCTCAAACGTAGTAATTCACAACCCCAACATAAATATTCTCTGGCTCCGCGGGTTGTTGCTCGATCACT
GTTATATTTTCTGTCTCTACAAACTCCCACTTTCCTAGCAGTTGATGCCACAGGTTTGGATATTTGGGCCAGCGAGACGGGTAGTGAATGGATCAACACG
AACCCACAGCAAGGAGAAGATAGAAGCGAGGAGGACAGCCCAGACGATGACAATCGTCGGTGTGCGGTTTTGCCTGCCCATAAGACCCTTGAGGAATGGG
TATAAGTGAACAATCACCCAGAAGGCAAAGAAGAGCTTCCCAAAGAGCGGCCCCCATGATTGGTAACCACTGTTGATGGCGTAGGAGGTGCCAGCAACGA
CACCAACCATGTTAATGATCAAAATGGTCGTCGGAGGGATGAGAAGCGTCGTCCACTTGAACATGTAGAGCTCAGCAAAGTCGCCTTCTTCGTCATTAGC
CTTTGAGGTGACAGTGAAGTTGGTGTCGATACCGGCAAGCACCTTCAGAAGACCCTGAAAGACGGCAAACAGATGTGCAGAGATACCTCCAATGACCCAG
AACTGTTCATTCCTCCACCACTCGTCAATGCCAACACCACTCCACCTCATCTCAAGGATACCAGTGGCGAAAATTGAAAGGAAGAGCGCAATGAACCAGA
TACTGGCCAAGTTGCTAATCTCTGGCATGATGAACTTTCCAGTGAGCAGACAGATAGCAGGCAATATACAATAGACTAGAAGCGGGAGAGAGGTTAGTGG
GTAAATGGTGGTGTTGATGTAAGCGAATCTCTCCAGGAACTTGAGGCGCCCTCCGTAGCCATACCATAAGGGGCAATGCCGGCTGAAAAGAATTTCAACA
GAACCGAGAGCCCACCGCAGCACTTGGTTCAGACGATCTGAAAGATTGATGGGGGCAGATCCCTTGAAAGCTGGGCGCTTGGGCATGCAATAGACTGAAC
GCCAGCCTCTTGCGTGCATCTTGAATCCAGTAAGAATATCTTCTGTGACAGATCCATAGATCCAACCAATCTCAGTTCCCCATTCAGACTTGTCCTCATA
GCCACAACTTATGACATGGATAGCTTCTTTCAAAAGAGATTCTGGAGTGGAGGACTGAGGAACACCACCATATTCCATCAGAGTGGAGGCAACAAATGCT
GCTGACTGGCCAAATCTCTTCTCTAAGCTCATTTGAGACATGAGAACTGATTTCTCATCATCAAACCCAGCACCTTCAACACCCTCCTCTATGTCTTCGA
GATTGAATACTGGAACAGAACTGTCCACATGCTTGTTCGACTTTTTCTTATCTGAGCTCCTTTCTTGACTGCT
page-top