Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23021  (registered. 2003)
Contig Information
Length 1102 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 5
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit Os02g0634900 [Oryza sativa (japonica cultivar-group)] >gi|49387541|dbj|BAD25097.1| alpha 2 subunit of 20S proteasome [Oryza sativa Japonica Group] >gi|113537047|dbj|BAF09430.1| Os02g0634900 [Oryza sativa (japonica cultivar-group)] >gi|215741147|dbj|BAG97642.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765416|dbj|BAG87113.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218191233|gb|EEC73660.1| hypothetical protein OsI_08192 [Oryza sativa Indica Group]
Score 1174
Evalue 1.23644e-126
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23021
TTTTTTTTTTAAAATGACCGAGCAAATCCAGAGATTGGCCAAACGAAACATACACCTAACATTAGGTTATCTTCCATGTCCACAATGCCATCCACAAGGA
TTCAAATGTAAGTTCTTCCGGTGTCACTGGGGCGAACCAGTTTACAATATGTTTAAGTGACCAATTTAAAACATGAGACAAGCTTCATGGACCGGAAACT
TTTCTTGTTGGAGACAGTAAATTGCCCAGGGGCAACTTACTCCACCTCTTCCAAGAAATCCTTGATCTCTGATGGAGTTAAAACTTTAAATTCACGGTCA
GCCCGGATAACTCCAATTTCAATGTTGTTGGCAGAGATTTGACCTTCATATCCTTCTTTCAGAGTCAAAATTGCAGTATGAATGGCATCATCAAGCTCCA
TATCTTCGGTGTATCTTTTCTCAAGAAATGTCTTTGCATTTGACACATTTTTCCCCATCGCTGATGCTTTCCAGGAGAAGTAAGATCCTGATGGGTCAAC
CTGATACAACTGCGGACCATTGTCATCATACCCAGCAATCAACAGTGATACACCAAATGGTCTTACACCACCAGATTGTGTGAACTCCTGCATAACAGCA
GCAGTCTCTCGGACAAGCTGGGTCACGGGGATGGTTTCCTTGTACAACCGATAATACTGCTGTGCCTGCTTCCGACTTTTTCTGACAAGAACGCGGAAAT
CTGGACCCATCCCACTGTAGACAACTCCAATATTTGGAGTCAGTGACTGAATCTTCTGCACAGATGTTTCGTCCACTAAAATAGAAGGCAATTTCTTCTC
AGTGGCGATAACTACACCATTGGCAGCTTTGATGCCAAGCGAGGTTTGGCCCGATCCGACGGCCGTGAGCGCGTGCTCGATCTGCACCAGCTTCCCCGAC
GGGCTGAAGGTGGTGAGGGAGAAGGAGTACTGGCTGTCGCCCATGGCCGACGTGCGGGACTACCTCGTCGGCTTTCTCGGGCTGCGGGAGGAGATCGGAC
GGAGCGAGAGGGCGAGGCGGCTGCTAGAGAAGAGAGACGGAGGGGGGATGGGACGGAAGTAGTGTCGAACGCGAAGAGAAGAGGAAAACGGAGAAGAGCA
GC
page-top