Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7643  (registered. 2012)
Contig Information
Length 1551 bp
Clones alternative view 39 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 4
Wh_DPA20 Seed DPA20 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 1
Wh_SHDr Shoot grown with dessication 4
Wh_VHS Shoot with heat shock treatment 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 4
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|283777738|gb|ADB28898.1|| 26S protease regulatory subunit-like protein [Lolium perenne]
Score 820
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7643
TTTTTTTTTTCGGCACAGAGCAATTGGTTAGAAATAATTTCTTCGGGTACAGGAAGGCACAAAGCAAGAGTGCTTCACACAATCAGGAGGATTCGAGACT
TAAACTATACTCCAAATAAAAATGGTAGCCGAGTGTTACAAACAGCGGCCATCACAGGACCAAGCGTTCTGATTACTCAAGGGAAACTAAGCGTAATAAT
TCAAGCTGGACTTCTTCTTTGCTTGCACTTGGATAATGCCTTCGTTGAAATCTTCATGGATCACCTCTGTAGCGTCCCTGCGTAGAGCAAGCATGCCAGC
TTCCACACAAACAGCCTTCAGTTGTGCACCGTTGAAATCATCAGTTGAACGAGCCAGCTCCTCAAAGTTGACATCAGGATGTACGTTCATCTTTCTTGAG
TGAATTTGCAAAATCCGAGCTCTTGCTTCTTCCGTCGGATGAGGGAACTCAATCTTTCTGTCCAGGCGACCAGAACGGAGTAAAGCAGGATCGAGAATAT
CTGCACGATTGGTTGCAGCTATCACCTTTATCCTCTCATCACTGCTAAATCCATCTAGCTGATTCAGCAACTCCAACATAGTTCGTTGCACTTCTCTGTC
ACCACTCACTTCACTGTCAAAACGCTTTGTTCCAATTGCATCAATCTCATCAATAAAAATGATGCAGGGGGCCTTCTCCTTTGCCAACTCAAAGGCATCT
CGGACAAGCTTTGCCCCATCACCGATGAACATCTGGACTAGCTGCGGACCAGCAAGTTTCAGAAAGGTTGCATTGGTTTGTGCAGCACATGCACGAGCCA
TCAACGTCTTTCCCGTCCCAGGTGGTCCATATAAAAGAACTCCTTTCGGGGGACGGATTCCCAACTTCTGAAATTGCTCCTTGTGTGTCATTGGCAACAC
TATAGCTTCAACGAGTTCCTGAATCTCTTTCTCAAGGCCGCCAATGTCATTATAATCCTCCGTAGGCTTTTCATCTACCTCCATTGCCTTTACTCGAGAG
TCATACTCCGAAGGTAGCGTGTCTAATATCAAGTAGCTGTCCTTGTTGACTCCAACCAAATCACCAGGCTTGAGGTTGTCAGGGTCAACTAGCCCGATCA
CAGGAAGGAATATAGTCTGTCTTGTGGATGTCTTAAGAACAACACATTTTCCTTTCCTCTGTGAGTCCAGATCTATATTAGCACCATCCTCTTCAGCCTC
ATCTTCAGGGTTCATTTCCAAAATCTCGACGATGTTGCCGACGAGGTAGGGCAGCTGCTTGTTGAGCTTTATCTTCTCCTGGTTCTCCTTGATCTTGTCC
TTGACGTTCTCGAGCTCCAGGTTGTTCCGCTGCAGCTCGTCCTTGAGGACGCGGACCTCGTTGTCGAGGAGGCGGGTGGCCCGGACGATGTCCTCCGTGG
ACATGGAGTCGAGCTGGTCGGTCTCCGACGAGTCGTCGACGGCCATCGCGGCGGCGCCGGCGTCTGGCGCGGGGGTAGGGGAGGACGACATGGCGCTCTG
CTGCGGCCTGGGCGGGTCGGAAGGGGAGGGGAGGCGGAGATTGCGCCTCGT
page-top