Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22988  (registered. 2003)
Contig Information
Length 883 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EMI Dormant seed with water absorption after breaking 6
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit Os08g0139000 [Oryza sativa (japonica cultivar-group)] >gi|38636774|dbj|BAD03017.1| putative RNA recognition motif (RRM)-containing protein [Oryza sativa Japonica Group] >gi|113622933|dbj|BAF22878.1| Os08g0139000 [Oryza sativa (japonica cultivar-group)] >gi|215767574|dbj|BAG99802.1| unnamed protein product [Oryza sativa Japonica Group]
Score 497
Evalue 2.74556e-48
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22988
TTTTTTTTTTCGCTTGCAAACGTGTTCTTATTCCGAGCTACGAGTCATTATCCAGTAGTACAAGAGCAGCACATGCCATCAGCAGCTGATAAGGCTTACG
ACAATTCAAATAAAAGGGACAAGAAGACATTATTAGCAATGGTCCGAAGCTGTTGCATGCTGACAGTAATACCTGCTCGGTCCATATAAGGTTCCCCTAG
TGCTTCTCCATGTGGAGGCCGTAAACGACCAGTCCAACACGACAAGAATATTGGATCAGGCAAGGGTGTTCACACCTGGGACAACACCATGGTAGCTATG
ATCTAAATGTAGACTGCGATGGCTGACTGATACGCTGTCAGACGCACAGCCAGGTAGAATGATTGTCCCTTCATCTACTGTGAGCCCCAGGAACCAGAAG
GAGTGCCCCATGATTGTTGTGGCTGCGGAGTTGCCCCTCCCATCTGCGGCGGTGGTCTGGGTCTAGCATATTCGGCAAAAATAACCCATCCATCCAGAAA
TTTTCCATCCATTCCTTCTATTCCTTTAGTTGCATCTTCAACCGAAACATACCTTACAAAGCCAAACCCCTTAGAAAAACCAGTGACACGATCTGTGACA
ACTCGAGCGTGTTCAACTTCCCCAAACTTTGCAAAAGCTTCTCTAAGTCCATCAGTTGTTGTACGCTTGCTTAGCCCGGAGACGAAGAGGTTGGGGGAGG
GGTCGGCCTTCGGGGGAGGCGTGGGCGGGCTCGGCGGCGCGAAGGCCGAGATGGAGAACATGCGCGTGTTCGGCGTCGCGAAGTCGGCGATGGAGAACAT
CCGTCGGAGCCCGGACCTTGCCGCCACCGCCGCCATAGCTGCCGCCGCCGGAGAATGGGGGAAAAGGCTTGCGTGCGTGAGAG
page-top