Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7640  (registered. 2012)
Contig Information
Length 810 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_VHS Shoot with heat shock treatment 1
WH_XC Root, treated at 50 microM Al for 6h 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218192137|gb|EEC74564.1|| hypothetical protein OsI_10115 [Oryza sativa Indica Group]
Score 234
Evalue 8.00E-60
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7640
AGTCGGCGATAGATCAGAGTACCAGTATCGACTACCAAATTCCAAGATGGAAGATAAAAGTAGATCTAAATACAGTAAAAAGGGAGTGAGAATTATATCC
CTGAAAGAAGCATTCTCATATATCTTCATTGCAGACATAGAGAAACAGTGAAGGGCAACGGAATCACAAAATGCTTCGATTCGTAACAGTATCAGTAGGA
TTAACTAGTTAAAACTAGGGGGACATTGCCTCATTTTTTTAACAAGGACAAAACTCTGAATGCATGAGCTCCTTGCTAACATCATCATGCAACTCATTAC
AGAAGAGACACTAAAGACATCACTTGCTGCAGCTCCAAATCAGAAGGAACATGAGCCTGTTGGGCTGCCTACAGAACGAAACGGTTAAGGCTCCGTCATT
GTTTTGGGGCGCACGCAGCCGCAGAAGGGCACCCTACTCTTCTTCTTCTGCCCGGCGTCATTCTTGTCCTTCTTTGCGTACACGTAGTCCCTCAAGAGCA
GCCGCGAACGCTTCTCCGAGACCTTGACCCTCTTGAACTCGTGCTCTTCCTCGAGCTTCAGCAGCACGTACTGTATCTTCTGGAGCTCGAGGTCCAGCCT
CGCGACCTTCTCCGACCCTTTCTGCACCTGCTCGGAGATCTTCCTTCTGCTGGAATAGCCCTCTAGGTCGGCATTCACCTCAAATGCAGGATAATTCTCA
GCCTTCTTCGTCAAACTGCTGTTGAAACCTATCTGTTCCAAGACAGAGCCCTCGATCTCCTGCAGCTGAGCCCTGATACTGCTGTACTCTGAGCTCATGG
GAGATTTGCC
page-top