Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22956  (registered. 2003)
Contig Information
Length 678 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 5
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VHS Shoot with heat shock treatment 2
Homology (BLAST) Top Hit predicted protein [Ajellomyces capsulatus NAm1] >gi|150407452|gb|EDN02993.1| predicted protein [Ajellomyces capsulatus NAm1]
Score 84
Evalue 1.29786
Total Hit Count 13
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22956
TTTTTTTTTTGAGTCAGTAAGTTTTTTTTATTATATATGCTCATTACCTTATACAGTAGATAAAAAGGAAAATTGCATAAACATACTAGATAACTAAATT
TTATTTTTACCAAAAGGAAGAAATACACAATCAAAAACTTGGAATTACAGATTTTTCCCCCTAGATCTGGCCTACTGTTTTGCCCAGAGATATTCTCCAG
CCACCACATCAAGCGCCGCCAGCCTTCGCGGGACGTCAATCGGAGTTCAACGCCATTGTTTTTCAGTCACAGATCTGGCAAACTTCTTTAAAACAATTTA
TAAAAAACACCACCAGAGATGCCCTTAGCGAGGCATTCGCTGCTGCTGCTCATATGGGGAGGCGCCGATGTGGGGGCGTCTCCTCCAGGAGGAAGTGGCC
AGCCAGCGGTGGCGCTGGATCCCGCGAGCAGTCTGACATCGTCGAGCTGGCCGACGACCCAAGCGAGGCGGGGAGGTAGGAACGGGGCGCTGGCGTCCGG
ATCCAGCCGGATCCCGACGAATTCAAAGGAGAATGACTGCTGGGAGGTGAGCTCGGGCGATGCCATGGGCGGTCGGCCTCCATTGCGGCGTGCTGTGGTG
GGAGGTTCGGGCGGCGGCACTCCGCGCGGACGGCGACGTCCGATGGCTGCGAGCTGTGGATTTCCTCGGGCGCGGCTG
page-top